seqret.txt
来自「emboss的linux版本的源代码」· 文本 代码 · 共 1,059 行 · 第 1/3 页
TXT
1,059 行
seqret Function Reads and writes (returns) sequencesDescription The simplicity of the above description of this program greatly understates the rich functionality of this program. Because EMBOSS programs can take a wide range of qualifiers that slightly change the behaviour of the program when reading or writing a sequence, this program can do many more things than simply "read and write a sequence". seqret can read a sequence or many sequences from databases, files, files of sequence names, the command-line or the output of other programs and then can write them to files, the screen or pass them to other programs. Because it can read in a sequence from a database and write it to a file, seqret is a program for extracting sequences from databases. Because it can write the sequence to the screen, seqret is a program for displaying sequences. seqret can read sequences in any of a wide range of standard sequence formats. You can specify the input and output formats being used. If you don't specify the input format, seqret will try a set of possible formats until it reads it in successfully. Because you can specify the output sequence format, seqret is a program to reformat a sequence. seqret can read in the reverse complement of a nucleic acid sequence. It therefore is a program for producing the reverse complement of a sequence. seqret can read in a sequence whose begin and end positions you have specified and write out that fragment. It is therefore a utility for doing simple extraction of a region of a sequence. seqret can change the case of the sequence being read in to upper or to lower case. It is therefore a simple sequence beautification utility. seqret can do any combination of the above functions. The sequence input and output specification of this (and many other EMBOSS programs) is described as being a Uniform Sequence Address. The Uniform Sequence Address, or USA, is a somewhat tongue-in-cheek reference to a URL-style sequence naming used by all EMBOSS applications. The USA is a very flexible way of specifying one or more sequences from a variety of sources and includes sequence files, database queries and external applications. See the full specification of USA syntax at: http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html The basic USA syntax is one of: * "file" * "file:entry" * "format::file" * "format::file:entry" * "database:entry" * "database" * "@file" Note that ':' separates the name of a file containing many possible entries from the specific name of a sequence entry in that file. It also separates the name of a database from an entry in that database Note also that '::' separates the specified format of a file from the name of the file. Normally the format can be omitted, in which case the program will attempt to identify the correct format when reading the sequence in and will default to using FASTA format when writing the sequence out. Valid names of the databases set up in your local implementation of EMBOSS can be seen by using the program 'showdb'. Database queries, and individual entries in files that have more than one sequence entry, use wildcards of "?" for any character and "*" for any string of characters. There are some problems with the Unix shell catching these characters so they do need to be hidden in quotes or preceded by a backslash on the Unix command line, (for example "embl:hs\*") The output USA name 'stdout' is special. It makes the output go to the device 'standard output'. This is the screen, by default. Example USAs The following are valid USAs for sequences: USA Description xxx.seq A sequence file "xxx.seq" in any format fasta::xxx.seq A sequence file "xxx.seq" in fasta format gcg::egmsmg.gcg A sequence file "egmsmg.gcg" in GCG 9 format egmsmg.gcg -sformat=gcg A sequence file "egmsmg.gcg" in GCG 9 format embl::paamir.em A sequence file "paamir.em" in EMBL format embl:paamir EMBL entry PAAMIR, using whatever access method is defined locally for the EMBL database embl:X13776 EMBL entry X13776, using whatever access method is defined locally for the EMBL database and searching by accession number and entry name (X13776 is the accession number in this case) embl-acc:X13776 EMBL entry X13776, using whatever access method is defined locally for the EMBL database and searching by accession number only embl-id:paamir EMBL entry PAAMIR, using whatever access method is defined locally for the EMBL database, and searching by ID only embl:paami* EMBL entries PAAMIB, PAAMIE and so on, usually in alphabetical order, using whatever access method is defined locally for the EMBL database embl or EMBL:* All sequences in the EMBL database @mylist Reads file mylist and uses each line as a separate USA. This is standard VMS list file syntax, also used in SRS 4.0 but missing in SRS 5.0. The list file is a list of USAs (one per line). List files can contain references to other lists files or any other standard USA. list::mylist Same as "@mylist" above 'getz -e [embl-id:paamir] |' The pipe character "|" causes EMBOSS to fire up getz (SRS 5.1) to extract entry PAAMIR from EMBL in EMBL format. Any application or script which writes one or more sequences to stdout can be used in this way. asis::atacgcagttatctgaccat So far the shortest USA we could invent. In 'asis' format the name is the sequence so no file needs to be opened. This is a special case. It was intended as a joke, but could be quite useful for generating command lines. Input sequence formats To date, the following sequence formats are accepted as input. By default, (i.e. if no format is explicitly specified) EMBOSS tries each format in turn until one succeeds. Input Format Comments gcg GCG 9.x and 10.x format with the format and sequence type identified on the first line of the file gcg8 GCG 8.x format where anything up to the first line containing ".." is considered as heading, and the remainder is sequence data. This format is complicated by the header appearing to be in other formats such as EMBL, and by the possibility of reading a large amount of data in the wrong format before discovering that there is no ".." line because it is not GCG format after all. embl em EMBL entry format, or at least a minimal subset of the fields. The Staden package and others use EMBL or similar formats for sequence data. swiss sw SWISSPROT entry format, or at least a minimal subset of the fields. fasta pearson FASTA format with an optional accession number after the sequence identifier, eg: >name description or >name accession description and with an optional database name in GCG style fasta format included as part of the sequence identifier, eg: >database:name accession description ncbi FASTA format with optional accession number and database name in NCBI style included as part of the sequence identifier. eg >database|accession|id description (and other variants on this theme!) genbank gb GENBANK entry format, or at least a minimal subset of the fields. nbrf pir NBRF (PIR) format, as used in the PIR database sequence files. codata CODATA format. strider DNA strider format clustal aln ClustalW ALN (multiple alignment) format. phylip PHYLIP interleaved multiple alignment format. acedb ACeDB format msf Wisconsin Package GCG's MSF multiple sequence format. hennig86 Hennig86 format jackknifer Jackknifer format jackknifernon Jackknifernon format nexus paup Nexus/PAUP format nexusnon paupnon Nexusnon/PAUPnon format treecon Treecon format mega Mega format meganon Meganon format ig IntelliGenetics format. staden experiment The experiment file format used by the "gap" program in the Staden package, where the sequence identifier is optional and the remainer is plain text. Some alternative nucleotide ambiguity codes are used and must be converted. unknown text plain Plain text. This is the format with no format. The whole of the file is read in as a sequence. No attempt is made to parse the file contents in any way. Anything is acceptable in this format. raw Like unknown/text/plain format except that it accepts only alphanumeric and whitespace characters and rejects anything else. asis This is not so much a sequence format as a quick way of entering a sequence on the command line, but it is included here for completeness. Where a filename would normally be given, in asis format there is the sequence itself. An example would be: asis::atacgcagttatctgaccat In 'asis' format the name is the sequence so no file needs to be opened. This is a special case. It was intended as a joke, but could be quite useful for generating command lines. Output sequence formats To date, the following sequence formats are available as output. Some sequence formats can hold multiple sequences in one file, these are marked as multiple in the following table. The details of how many sequences are held in one file differs between formats, but they either allow many sequences to be concatenated one after the other, or they hold the sequences together in some sort of aligned set of sequences. Other formats, such as GCG, plain and staden formats can only hold one sequence per file, these are marked as single. An attempt to concatenate several sequences in one file leaves the results as a mess that makes it impossible to decide where the sequences start and end or what is annotation and what is sequence. These single formats therefore cause problems when there are multiple sequences to write out because a single file containing multiple sequences in that format is invalid. When these formats are specified for output, an EMBOSS program will allow you to write many sequences to one file, but EMBOSS programs will not be able to reliably read in the resulting mess. N.B This behaviour changed in EMBOSS version 1.7.0. (31 Oct 2000) Previously, EMBOSS programs that were asked to write multiple sequences in a single format would ignore the requested output file name and would write each sequence into a separate file whose name was constructed from the sequence name and the name of the format. This resulted in ouput to files whose names could not be reliably controlled. A decision was taken that EMBOSS users were intelligent people who could live with the consequences of their actions and who could learn not to write out multiple sequences to a file in formats that could not cope with multiple sequences. It you really wish to write multiple sequences out in formats that can not cope with multiple sequences, you are advised to add the global qualifier -ossingle on the command line. This will force the EMBOSS program to ignore the given output file name and will generate its own file names. One sequence will be written to each such file. These file names are made from the sequence ID name, with the name of the format as the extension (e.g. hsfau.gcg). This is not ideal. Preferably, you should stay away from formats that can't cope with multiple sequences in a file. Output Format Single/ Multiple Comments gcg single Wisconsin Package GCG 9.x and 10.x format with the sequence type on the first line of the file. gcg8 single GCG 8.x format where anything up to the first line containing ".." is considered as heading, and the remainder is sequence data. embl em multiple EMBL entry format with available fields filled in and others with no infomation omitted. The EMBOSS command line allows missing data such as accession numbers to be provided if they are not obtainable from the input sequence. swiss sw multiple SwisProt entry format with available fields filled in and others with no infomation omitted. The EMBOSS command line allows missing data such as accession numbers to be provided if they are not obtainable from the input sequence. fasta multiple Standard Pearson FASTA format, but with the accession number included after the identifier if available. pearson multiple Simple Pearson FASTA format, an alias for "fasta" format. ncbi multiple NCBI style FASTA format with the database name, entry name and accession number separated by pipe ("|") characters. nbrf pir multiple NBRF (PIR) format, as used in the PIR database sequence files. genbank gb multiple GENBANK entry format with available fields filled in and others with no infomation omitted. The EMBOSS command line allows missing data such as accession numbers to be provided if they are not obtainable from the input sequence. ig multiple Intelligenetics format, as used by the Intelligenetics package codata multiple CODATA format. strider multiple DNA strider format acedb multiple ACeDB format staden experiment single The experiment file format used by the "gap" program in the Staden package. Some alternative nucleotide ambiguity codes are used and are converted. text plain raw single Plain sequence, no annotation or heading. fitch multiple Fitch format msf multiple Wisconsin Package GCG's MSF multiple sequence format. clustal aln multiple Clustal multiple sequence format. phylip multiple PHYLIP non-interleaved format. phylip3 multiple PHYLIP interleaved format. asn1 multiple A subset of ASN.1 containing entry name, accession number, description and sequence, similar to the current ASN.1 output of readseq hennig86 multiple Hennig86 format mega multiple Mega format meganon multiple Meganon format nexus paup multiple Nexus/PAUP format nexusnon paupnon multiple Nexusnon/PAUPnon format jackknifer multiple Jackknifer format jackknifernon multiple Jackknifernon format treecon multiple Treecon format debug multiple EMBOSS sequence object report for debugging showing all available fields. Not all fields will contain data - this depends very much on the input format used. Future directions More formats, both for input and for output, can be easily added, so suggestions are always welcome. Associated qualifiers As noted previously there are many 'associated' qualifiers that alter the behaviour of seqret when it reads in or writes out a sequence. As these are used in all EMBOSS programs that read in or write out sequences, they are not reported by the '-help' qualifier. They are however reported by the pair of qualifiers: '-help -verbose': Some of the more useful associated qualifiers are: Qualifier Description -sbegin The first position to be used in the sequence -send The last position to be used in the sequence -sreverse Use the reverse complement of a nucleic acid sequence -sask Ask the user for begin/end/reverse information -slower Convert the sequence to lower case -supper Convert the sequence to upper case -sformat Specify the input sequence format -osformat Specify the output sequence format -ossingle Write each entry into a separate file -auto Turn off prompts and don't report the one-line description -stdout Write the results to 'standard output' (the screen) -filter Read input from another program, write to the screen -options Prompt for optional qualifiers -help Display a table of the command-line options The set of associated qualifiers for sequences behave in different
⌨️ 快捷键说明
复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?