seqret.txt

emboss的linux版本的源代码

                                  seqret 



Function

   Reads and writes (returns) sequences

Description

   The simplicity of the above description of this program greatly
   understates the rich functionality of this program.

   Because EMBOSS programs can take a wide range of qualifiers that
   slightly change the behaviour of the program when reading or writing a
   sequence, this program can do many more things than simply "read and
   write a sequence".

   seqret can read a sequence or many sequences from databases, files,
   files of sequence names, the command-line or the output of other
   programs and then can write them to files, the screen or pass them to
   other programs. Because it can read in a sequence from a database and
   write it to a file, seqret is a program for extracting sequences from
   databases. Because it can write the sequence to the screen, seqret is
   a program for displaying sequences.

   seqret can read sequences in any of a wide range of standard sequence
   formats. You can specify the input and output formats being used. If
   you don't specify the input format, seqret will try a set of possible
   formats until it reads it in successfully. Because you can specify the
   output sequence format, seqret is a program to reformat a sequence.

   seqret can read in the reverse complement of a nucleic acid sequence.
   It therefore is a program for producing the reverse complement of a
   sequence.

   seqret can read in a sequence whose begin and end positions you have
   specified and write out that fragment. It is therefore a utility for
   doing simple extraction of a region of a sequence.

   seqret can change the case of the sequence being read in to upper or
   to lower case. It is therefore a simple sequence beautification
   utility.

   seqret can do any combination of the above functions.

   The sequence input and output specification of this (and many other
   EMBOSS programs) is described as being a Uniform Sequence Address.

   The Uniform Sequence Address, or USA, is a somewhat tongue-in-cheek
   reference to a URL-style sequence naming used by all EMBOSS
   applications.

   The USA is a very flexible way of specifying one or more sequences
   from a variety of sources and includes sequence files, database
   queries and external applications.

   See the full specification of USA syntax at:
   http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html 

   The basic USA syntax is one of:
     * "file"
     * "file:entry"
     * "format::file"
     * "format::file:entry"
     * "database:entry"
     * "database"
     * "@file"

   Note that ':' separates the name of a file containing many possible
   entries from the specific name of a sequence entry in that file. It
   also separates the name of a database from an entry in that database

   Note also that '::' separates the specified format of a file from the
   name of the file. Normally the format can be omitted, in which case
   the program will attempt to identify the correct format when reading
   the sequence in and will default to using FASTA format when writing
   the sequence out.

   Valid names of the databases set up in your local implementation of
   EMBOSS can be seen by using the program 'showdb'.

   Database queries, and individual entries in files that have more than
   one sequence entry, use wildcards of "?" for any character and "*" for
   any string of characters. There are some problems with the Unix shell
   catching these characters so they do need to be hidden in quotes or
   preceded by a backslash on the Unix command line, (for example
   "embl:hs\*")

   The output USA name 'stdout' is special. It makes the output go to the
   device 'standard output'. This is the screen, by default.

  Example USAs

   The following are valid USAs for sequences:

   USA Description
   xxx.seq A sequence file "xxx.seq" in any format
   fasta::xxx.seq A sequence file "xxx.seq" in fasta format
   gcg::egmsmg.gcg A sequence file "egmsmg.gcg" in GCG 9 format
   egmsmg.gcg -sformat=gcg A sequence file "egmsmg.gcg" in GCG 9 format
   embl::paamir.em A sequence file "paamir.em" in EMBL format
   embl:paamir EMBL entry PAAMIR, using whatever access method is defined
   locally for the EMBL database
   embl:X13776 EMBL entry X13776, using whatever access method is defined
   locally for the EMBL database and searching by accession number and
   entry name (X13776 is the accession number in this case)
   embl-acc:X13776 EMBL entry X13776, using whatever access method is
   defined locally for the EMBL database and searching by accession
   number only
   embl-id:paamir EMBL entry PAAMIR, using whatever access method is
   defined locally for the EMBL database, and searching by ID only
   embl:paami* EMBL entries PAAMIB, PAAMIE and so on, usually in
   alphabetical order, using whatever access method is defined locally
   for the EMBL database
   embl or EMBL:* All sequences in the EMBL database
   @mylist Reads file mylist and uses each line as a separate USA. This
   is standard VMS list file syntax, also used in SRS 4.0 but missing in
   SRS 5.0. The list file is a list of USAs (one per line). List files
   can contain references to other lists files or any other standard USA.
   list::mylist Same as "@mylist" above
   'getz -e [embl-id:paamir] |' The pipe character "|" causes EMBOSS to
   fire up getz (SRS 5.1) to extract entry PAAMIR from EMBL in EMBL
   format. Any application or script which writes one or more sequences
   to stdout can be used in this way.
   asis::atacgcagttatctgaccat So far the shortest USA we could invent. In
   'asis' format the name is the sequence so no file needs to be opened.
   This is a special case. It was intended as a joke, but could be quite
   useful for generating command lines.

  Input sequence formats

   To date, the following sequence formats are accepted as input.

   By default, (i.e. if no format is explicitly specified) EMBOSS tries
   each format in turn until one succeeds.

   Input Format Comments
   gcg GCG 9.x and 10.x format with the format and sequence type
   identified on the first line of the file
   gcg8 GCG 8.x format where anything up to the first line containing
   ".." is considered as heading, and the remainder is sequence data.
   This format is complicated by the header appearing to be in other
   formats such as EMBL, and by the possibility of reading a large amount
   of data in the wrong format before discovering that there is no ".."
   line because it is not GCG format after all.
   embl
   em EMBL entry format, or at least a minimal subset of the fields. The
   Staden package and others use EMBL or similar formats for sequence
   data.
   swiss
   sw SWISSPROT entry format, or at least a minimal subset of the fields.
   fasta
   pearson FASTA format with an optional accession number after the
   sequence identifier, eg:
   >name description
   or
   >name accession description
   and with an optional database name in GCG style fasta format included
   as part of the sequence identifier, eg:
   >database:name accession description
   ncbi FASTA format with optional accession number and database name in
   NCBI style included as part of the sequence identifier. eg
   >database|accession|id description
   (and other variants on this theme!)
   genbank
   gb GENBANK entry format, or at least a minimal subset of the fields.
   nbrf
   pir NBRF (PIR) format, as used in the PIR database sequence files.
   codata CODATA format.
   strider DNA strider format
   clustal
   aln ClustalW ALN (multiple alignment) format.
   phylip PHYLIP interleaved multiple alignment format.
   acedb ACeDB format
   msf Wisconsin Package GCG's MSF multiple sequence format.
   hennig86 Hennig86 format
   jackknifer Jackknifer format
   jackknifernon Jackknifernon format
   nexus
   paup Nexus/PAUP format
   nexusnon
   paupnon Nexusnon/PAUPnon format
   treecon Treecon format
   mega Mega format
   meganon Meganon format
   ig IntelliGenetics format.
   staden
   experiment The experiment file format used by the "gap" program in the
   Staden package, where the sequence identifier is optional and the
   remainer is plain text. Some alternative nucleotide ambiguity codes
   are used and must be converted.
   unknown
   text
   plain Plain text. This is the format with no format. The whole of the
   file is read in as a sequence. No attempt is made to parse the file
   contents in any way. Anything is acceptable in this format.
   raw Like unknown/text/plain format except that it accepts only
   alphanumeric and whitespace characters and rejects anything else.
   asis This is not so much a sequence format as a quick way of entering
   a sequence on the command line, but it is included here for
   completeness. Where a filename would normally be given, in asis format
   there is the sequence itself. An example would be:
   asis::atacgcagttatctgaccat
   In 'asis' format the name is the sequence so no file needs to be
   opened. This is a special case. It was intended as a joke, but could
   be quite useful for generating command lines.

  Output sequence formats

   To date, the following sequence formats are available as output.

   Some sequence formats can hold multiple sequences in one file, these
   are marked as multiple in the following table. The details of how many
   sequences are held in one file differs between formats, but they
   either allow many sequences to be concatenated one after the other, or
   they hold the sequences together in some sort of aligned set of
   sequences.

   Other formats, such as GCG, plain and staden formats can only hold one
   sequence per file, these are marked as single. An attempt to
   concatenate several sequences in one file leaves the results as a mess
   that makes it impossible to decide where the sequences start and end
   or what is annotation and what is sequence.

   These single formats therefore cause problems when there are multiple
   sequences to write out because a single file containing multiple
   sequences in that format is invalid. When these formats are specified
   for output, an EMBOSS program will allow you to write many sequences
   to one file, but EMBOSS programs will not be able to reliably read in
   the resulting mess.

   N.B This behaviour changed in EMBOSS version 1.7.0. (31 Oct 2000)
   Previously, EMBOSS programs that were asked to write multiple
   sequences in a single format would ignore the requested output file
   name and would write each sequence into a separate file whose name was
   constructed from the sequence name and the name of the format. This
   resulted in ouput to files whose names could not be reliably
   controlled. A decision was taken that EMBOSS users were intelligent
   people who could live with the consequences of their actions and who
   could learn not to write out multiple sequences to a file in formats
   that could not cope with multiple sequences.

   It you really wish to write multiple sequences out in formats that can
   not cope with multiple sequences, you are advised to add the global
   qualifier -ossingle on the command line. This will force the EMBOSS
   program to ignore the given output file name and will generate its own
   file names. One sequence will be written to each such file. These file
   names are made from the sequence ID name, with the name of the format
   as the extension (e.g. hsfau.gcg).

   This is not ideal. Preferably, you should stay away from formats that
   can't cope with multiple sequences in a file.

   Output Format Single/
   Multiple Comments
   gcg single Wisconsin Package GCG 9.x and 10.x format with the sequence
   type on the first line of the file.
   gcg8 single GCG 8.x format where anything up to the first line
   containing ".." is considered as heading, and the remainder is
   sequence data.
   embl
   em multiple EMBL entry format with available fields filled in and
   others with no infomation omitted. The EMBOSS command line allows
   missing data such as accession numbers to be provided if they are not
   obtainable from the input sequence.
   swiss
   sw multiple SwisProt entry format with available fields filled in and
   others with no infomation omitted. The EMBOSS command line allows
   missing data such as accession numbers to be provided if they are not
   obtainable from the input sequence.
   fasta multiple Standard Pearson FASTA format, but with the accession
   number included after the identifier if available.
   pearson multiple Simple Pearson FASTA format, an alias for "fasta"
   format.
   ncbi multiple NCBI style FASTA format with the database name, entry
   name and accession number separated by pipe ("|") characters.
   nbrf
   pir multiple NBRF (PIR) format, as used in the PIR database sequence
   files.
   genbank
   gb multiple GENBANK entry format with available fields filled in and
   others with no infomation omitted. The EMBOSS command line allows
   missing data such as accession numbers to be provided if they are not
   obtainable from the input sequence.
   ig multiple Intelligenetics format, as used by the Intelligenetics
   package
   codata multiple CODATA format.
   strider multiple DNA strider format
   acedb multiple ACeDB format
   staden
   experiment single The experiment file format used by the "gap" program
   in the Staden package. Some alternative nucleotide ambiguity codes are
   used and are converted.
   text
   plain
   raw single Plain sequence, no annotation or heading.
   fitch multiple Fitch format
   msf multiple Wisconsin Package GCG's MSF multiple sequence format.
   clustal
   aln multiple Clustal multiple sequence format.
   phylip multiple PHYLIP non-interleaved format.
   phylip3 multiple PHYLIP interleaved format.
   asn1 multiple A subset of ASN.1 containing entry name, accession
   number, description and sequence, similar to the current ASN.1 output
   of readseq
   hennig86 multiple Hennig86 format
   mega multiple Mega format
   meganon multiple Meganon format
   nexus
   paup multiple Nexus/PAUP format
   nexusnon
   paupnon multiple Nexusnon/PAUPnon format
   jackknifer multiple Jackknifer format
   jackknifernon multiple Jackknifernon format
   treecon multiple Treecon format
   debug multiple EMBOSS sequence object report for debugging showing all
   available fields. Not all fields will contain data - this depends very
   much on the input format used.

  Future directions

   More formats, both for input and for output, can be easily added, so
   suggestions are always welcome.

  Associated qualifiers

   As noted previously there are many 'associated' qualifiers that alter
   the behaviour of seqret when it reads in or writes out a sequence. As
   these are used in all EMBOSS programs that read in or write out
   sequences, they are not reported by the '-help' qualifier. They are
   however reported by the pair of qualifiers: '-help -verbose':

   Some of the more useful associated qualifiers are:

   Qualifier                        Description
   -sbegin   The first position to be used in the sequence
   -send     The last position to be used in the sequence
   -sreverse Use the reverse complement of a nucleic acid sequence
   -sask     Ask the user for begin/end/reverse information
   -slower   Convert the sequence to lower case
   -supper   Convert the sequence to upper case
   -sformat  Specify the input sequence format
   -osformat Specify the output sequence format
   -ossingle Write each entry into a separate file
   -auto     Turn off prompts and don't report the one-line description
   -stdout   Write the results to 'standard output' (the screen)
   -filter   Read input from another program, write to the screen
   -options  Prompt for optional qualifiers
   -help     Display a table of the command-line options

   The set of associated qualifiers for sequences behave in different