mast-output.html

来自「EM算法的改进」· HTML 代码 · 共 199 行

HTML
199 行
字号
<!---#### $Id: mast-output.html 1339 2006-09-21 19:46:28Z tbailey $#### $Log$## Revision 1.2  2006/03/07 23:30:20  nadya## merge branches v3_5_1 and v3_5_2 back to the trunk#### Revision 1.1.1.1.6.2  2006/02/23 00:23:47  nadya## close tags#### Revision 1.1.1.1.6.1  2006/02/22 20:49:02  nadya## enabling styling with js and css#### Revision 1.1.1.1  2005/07/31 20:16:17  nadya## Importing from meme-3.0.14, and adding configure/make####---><HTML><HEAD><TITLE>MAST - Output</TITLE><script src="template-css.js" type="text/javascript"></script></HEAD><body class="body">      <script src="template-header.js" type="text/javascript"></script>	      <H1>MAST -- Motif Alignment and Search Tool</H1>      <H2><I>Motif search tool</I></H2>      <HR>      <h3>MAST sends you two e-mail messages:</h3> <MENU>      <LI> <A HREF="#confirmation"><B>a confirmation message</B></A> and      <LI> your <A HREF="#results"><B>search results</B></A>.       </MENU><font> The e-mail messages and how MAST computes <A HREF=#score><B>match scores</B></A> and their statistical significance <A HREF=#pvalues><B>(p-values)</B></A> are explained in the following sections. A <A HREF="#sample"><B>sample</B></A> search results file is also provided. </font>      <P> Return to <A href="mast-intro.html"><B>MAST introduction</B></A>.      <HR>      <P>       <A NAME="confirmation"></a>      <LI>        <H3> Confirmation message </H3>        The first e-mail message you receive should be a confirmation message to let you know that your search request has been received. You should receive an e-mail message that looks something like this:        <PRE>Subject: MAST confirmation: alcohol dehydrogenase motifs Your MAST search request 14019 is being processed:Motif file: adhDatabase to search: SwissProt</PRE>        If you fail to receive the confirmation message, check your e-mail address and try resubmitting your MAST request.        <P> <A NAME=results></a>      <LI>        <H3> Search Results </H3>        The second e-mail message you should receive contains the results of the MAST search. It contains:        <P>        <UL>          <LI> the <B>version</B> of MAST and the date it was built,          <LI> the <B>reference</B> to cite if you use MAST in your research,          <LI> a description of the <A HREF=#db_motifs><B>database and motifs</B></A> used in the search,          <LI> an <B>explanation</B> of the results          <LI> <A HREF=#names><B>high-scoring sequences</B></A>--sequences matching the group of motifs above a stated level of <A HREF=#pvalues><B>statistical significance</B></A>,          <LI> <A HREF=#diagrams><B>motif diagrams</B></A> showing the order and spacing of occurrences of the motifs in the high-scoring sequences and          <LI> <A HREF=#annotation><B>annotated sequences</B></A> showing the positions and p-values of all motif occurrences in each of the high-scoring sequences.        </UL>        <P> Each section of the results file contains an explanation of how to interpret them.        <P> <A NAME="score"></a>      <LI>        <H3> Match Scores</H3>        The match score of a motif to a position in a sequence is the sum of the score from each row of the position-dependent scoring matrix corresponding to the letter at that position in the sequence. For example, if the sequence is        <PRE>TAATGTTGGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGC   ========</PRE>        and the motif is represented by the position-dependent scoring matrix (where each row of the matrix corresponds to a position in the motif)        <PRE>=========|=================================POSITION |   A        C        G        T=========|=================================  1	 | 1.447    0.188   -4.025   -4.095   2	 | 0.739    1.339   -3.945   -2.325   3	 | 1.764   -3.562   -4.197   -3.895   4	 | 1.574   -3.784   -1.594   -1.994   5	 | 1.602   -3.935   -4.054   -1.370   6	 | 0.797   -3.647   -0.814    0.215   7	 |-1.280    1.873   -0.607   -1.933   8	 |-3.076    1.035    1.414   -3.913 =========|=================================</PRE>        then the match score of the fourth position in the sequence (underlined) would be found by summing the score for <TT>T</TT> in position 1, <TT>G</TT> in position 2 and so on until <TT>G</TT> in position 8. So the match score would be        <PRE>  score = -4.095 + -3.945 + -3.895 + -1.994	  + -4.054 + -0.814 + -1.933 + 1.414 	= -19.316</PRE>        The match scores for other positions in the sequence are calculated in the same way. <I>Match scores are only calculated if the match completely fits within the sequence.</I> Match scores are <I>not</I> calculated if the motif would overhang either end of the sequence.        <P> <A NAME="pvalues"></a>      <LI>        <H3>P-values</H3>        MAST reports all matches of a sequence to a motif or group of motifs in terms of the p-value of the match. MAST considers the p-values of four types of events:        <UL>          <LI> <A HREF="#position"><B>position p-value:</B></A> the match of a single position within a sequence to a given motif,          <LI> <A HREF="#sequence"><B>sequence p-value:</B></A> the best match of any position within a sequence to a given motif,          <LI> <A HREF="#combined"><B>combined p-value:</B></A> the combined best matches of a sequence to a group of motifs, and          <LI> <A HREF="#evalue"><B>e-value:</B></A> observing a combined p-value at least as small in a random database of the same size.        </UL>        All p-values are based on a random sequence model that assumes each position in a random sequence is generated according to the average letter frequencies of all sequences in the the appropriate (peptide or nucleotide) non-redundant database <A HREF="ftp://ftp.ncbi.nih.gov/blast/db/"> (ftp://ftp.ncbi.nih.gov/blast/db/)</A> on September 22, 1996.        <UL>          <A NAME="position">          <H4>Position p-value</H4>          <font> The p-value of a match of a <B>given position</B> within a sequence to a <B>motif</B> is defined as the probability of a randomly selected position in a randomly generated sequence having a <A HREF="#score"><B>match score</B></A> at least as large as that of the given position. </font> <A NAME="sequence">          <H4>Sequence p-value</H4>          <font> The p-value of a match of a <B>sequence</B> to a <B>motif</B> is defined as the probability of a randomly generated sequence of the same length having a match score at least as large as the largest match score of any position in the sequence. </font> <A NAME="combined">          <H4>Combined p-value</H4>          <font> The p-value of a match of a <B>sequence</B> to a <B>group of motifs</B> is defined as the probability of a randomly generated sequence of the same length having sequence p-values whose <B>product</B> is at least as small as the product of the sequence p-values of the matches of the motifs to the given sequence. </font> <A NAME="evalue">          <H4>E-value</H4>          <font> The e-value of the match of a <B>sequence</B> in a <B>database</B> to a a <B>group of motifs</B> is defined as the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database. </font>        </UL>        <P> <A NAME="db_motifs">      <LI>        <H3><A HREF="mast-output-example.html#motifs">Database and Motifs</A></H3>        This section shows information on the database that was searched and the motifs in the search query. The database section gives the date the database was last updated as well as the number of sequences and total sequence characters in it. The motifs are listed by motif number. The width and subsequence which would be given the best possible score for each motif is shown. If there is more than one motif in the query, all pairwise correlations between the motifs are shown. The correlations can range from -1 to +1, with +1 meaning that the shorter motif is exactly identical to part or all of the longer motif. High correlations can cause some combined p-values and e-values to be inaccurate (too low). It may be advisable to remove enough motifs from the query to insure that no pairs of motifs have high correlations. Any high correlations are indicated along with the suggestion that one of the motifs be removed from the query.        <P> <A NAME="names">      <LI>        <H3><A HREF="mast-output-example.html#sec_i">High-scoring Sequences</A></H3>        MAST lists the names and part of the descriptive text of all sequences whose <A HREF="#evalue">e-value</A> is less than <I>E</I>. Sequences shorter than one or more of the motifs are skipped. The sequences are sorted by increasing e-value. The value of <I>E</I> is set to 10 for the WEB server but is user-selectable in the down-loadable version of MAST.        <P> When nucleotide sequences are searched, the strand (+ or -) is indicated. When nucleotide sequences are searched with peptide motifs, the reading frame (a, b or c) of the best matches is is also indicated. Matches are not all required to be in the same reading frame but must all be on the same strand.        <P> <A NAME="diagrams">      <LI>        <H3><A HREF="mast-output-example.html#sec_ii">Motif Diagrams</A></H3>        Motif diagrams show the order and spacing of non-overlapping matches to the motifs in each high-scoring sequence. Motif occurrences are determined based on the <A HREF="#position">position p-value</A> of matches to the motif. In the <A HREF="mast-output-example.html#sec_ii">MOTIF DIAGRAMS</A> section of the output, diagrams are shown like this:        <CENTER>          <BR>          <TABLE BORDER=0 CELLPADDING=0>            <TR ALIGN=CENTER>              <TD WIDTH=65><HR SIZE=4 NOSHADE>              <TD BGCOLOR=lime WIDTH=46>6              <TD WIDTH=11><HR SIZE=4 NOSHADE>              <TD BGCOLOR=fuchsia WIDTH=16>4              <TD WIDTH=24><HR SIZE=4 NOSHADE>              <TD BGCOLOR=red WIDTH=14>              <FONT COLOR=white>              3              <TD WIDTH=30><HR SIZE=4 NOSHADE>              <TD BGCOLOR=yellow WIDTH=32>5              <TD WIDTH=64><HR SIZE=4 NOSHADE>              <TD BGCOLOR=teal WIDTH=40>              <FONT COLOR=white>              7              <TD WIDTH=39><HR SIZE=4 NOSHADE>          </TABLE>        </CENTER>        <P> In the <A HREF="mast-output-example.html#sec_iii">ANNOTATED SEQUENCES</A> section of the output, diagrams are shown like this:        <CENTER>          <PRE>27-[3]-44-<4>-99-[1]-7</PRE>        </CENTER>        <font> In this notation, strong matches (p-value &lt <I>M</I>) are shown in square brackets <NOBR>(`[ ]')</NOBR>, weak matches (<I>M</I> &lt p-value &lt <I>M</I> &times 10) are shown in angle brackets <NOBR>(`< >')</NOBR> and the length of non-motif sequence ("spacer") is shown between dashes (`-'). The example above shows an initial spacer of length 27, followed by a strong match to motif 3, a spacer of length 44, a weak match to motif 4, a spacer of length 99, a strong match to motif 1 and a final non-motif sequence of length 7. The value of <I>M</I> is 0.0001 for the WEB server but is user-selectable in the down-loadable version of MAST.        <P> When nucleotide databases are searched, all matches must be on the same strand and the strand (+ or -) is indicated in the output. When peptide motifs are used to search nucleotide sequences, the reading frame (a, b or c) of each match is indicated next to the motif numbers in the motif diagrams found in the ANNOTATED SEQUENCES section of the output. For example, </font>        <CENTER>          <PRE>97-[6b]-17-[4a]-36-[3a]-45-[5a]-96-[7a]-59</PRE>        </CENTER>        shows that motif 6 matched in reading frame b while the other motif matches occurred in reading frame a.        <P> <B>Note:</B> If you specify the -hit_list switch to MAST, the motif "diagram" takes the form of a comma separated list of motif occurrences ("hits"). Each "hit" has the format:        <PRE>        &lt;strand&gt;&lt;motif&gt; &lt;start&gt; &lt;end&gt; &lt;p-value&gt;where        &lt;strand&gt;	is the strand (+ or - for DNA, blank for protein),        &lt;motif&gt;		is the motif number,        &lt;start&gt;		is the starting position of the hit,        &lt;end&gt;		is the ending position of the hit, and        &lt;p-value&gt;	is the position p-value of the hit.</PRE>        <P> <A NAME="annotation">      <LI>        <H3><A HREF="mast-output-example.html#sec_iii">Annotated Sequences</A></H3>        MAST annotates each high-scoring sequence by printing the sequence along with the position and strength of all the non-overlapping motif occurrences. The four lines above each motif occurrence contain, respectively,        <UL>          <LI> the motif number of the occurrence,          <LI> the <A HREF="#position">position p-value</A> of the occurrence,          <LI> the best possible match to the motif, and          <LI> a plus sign (`+') above each letter in the occurrence that has a positive match score to the motif.        </UL>        The <B>best possible match</B> to a motif is the sequence of letters which would achieve the highest match score.        <P> When peptide motifs are used to search nucleotide sequences, the reading frame (a, b or c) of each match is indicated with the motif number and the peptide translation of the matching sequence is shown just above the motif occurrence.        <P> <A NAME="sample">      <LI>        <H3>        <A HREF="mast-output-example.html">Sample MAST Search Results</A>        </H4>        Here is an actual <A HREF="mast-output-example.html"> MAST search results file </A> of a search of a nucleotide database with peptide motifs. It has been edited slightly to reduce its size by removing most of the 832 sequences which matched the motifs.        <P> <A HREF="mast.html"><B>Search using MAST</B></A> <BR>          <A href="mast-intro.html"><B>MAST introduction</B></A> <BR>          <A HREF="intro.html"><B>MEME SYSTEM introduction</B></A> <script src="template-footer.js" type="text/javascript"></script> </BODY></HTML>

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?