mast.doc

来自「EM算法的改进」· DOC 代码 · 共 199 行

	[-sep]		score reverse complement DNA strand as a separate 
			sequence
	[-norc]		do not score reverse complement DNA strand
	[-dna]		translate DNA sequences to protein
	[-comp]		adjust p-values and E-values for sequence composition
	[-rank <rank>]	print results starting with <rank> best (default: 1)
	[-smax <smax>]	print results for no more than <smax> sequences
			(default: all)
	[-ev <ev>]	print results for sequences with E-value < <ev>
			(default: 10)
	[-mt <mt>]	show motif matches with p-value < mt (default: 0.0001)
	[-w]		show weak matches (mt<p-value<mt*10) in angle brackets
	[-bfile <bfile>]	read background frequencies from <bfile>
	[-seqp]		use SEQUENCE p-values for motif thresholds
			(default: use POSITION p-values)
	[-mf <mf>]	print <mf> as motif file name
	[-df <df>]	print <df> as database name
	[-minseqs <minseqs>]	lower bound on number of sequences in db
	[-mev <mev>]+	use only motifs with E-values less than <mev>
	[-m <m>]+	use only motif(s) number <m> (overrides -mev)
	[-diag <diag>]	nominal order and spacing of motifs
	[-best]		include only the best motif in diagrams
	[-remcorr]	remove highly correlated motifs from query
	[-brief]	brief output--do not print documentation
	[-b]		print only sections I and II
	[-nostatus]	do not print progress report
	[-hit_list]	print machine-readable list of all hits only; implies -text

 
 MAST: Motif Alignment and Search Tool
 
 MAST is a tool for searching biological sequence databases for sequences
 that contain one or more of a group of known motifs. 
 
 A motif is a sequence pattern that occurs repeatedly in a group of related
 protein or DNA sequences. Motifs are represented as position-dependent
 scoring matrices that describe the score of each possible letter at each
 position in the pattern. Individual motifs may not contain gaps. Patterns with
 variable-length gaps must be split into two or more separate motifs before
 being submitted as input to MAST. 
 
 MAST takes as input a file containing the descriptions of one or more motifs
 and searches a sequence database that you select for sequences that match
 the motifs. The motif file can be the output of the MEME motif discovery tool 
 or any file in the appropriate format. 
 
 MAST outputs three things: 
 
   1. The names of the high-scoring sequences sorted by the strength of the
      combined match of the sequence to all of the motifs in the group. 
   2. Motif diagrams showing the order and spacing of the motifs within each
      matching sequence. 
   3. Detailed annotation of each matching sequence showing the sequence
      and the locations and strengths of matches to the motifs. 
 
 MAST works by calculating match scores for each sequence in the database
 compared with each of the motifs in the group of motifs you provide. For each
 sequence, the match scores are converted into various types of p-values and
 these are used to determine the overall match of the sequence to the group of
 motifs and the probable order and spacing of occurrences of the motifs in the
 sequence. 
 
 MAST outputs a file containing:
 
     * the version of MAST and the date it was built, 
     * the reference to cite if you use MAST in your research, 
     * a description of the database and motifs used in the search, 
     * an explanation of the results,
     * high-scoring sequences--sequences matching the group of motifs
       above a stated level of statistical significance, 
     * motif diagrams showing the order and spacing of occurrences of the
       motifs in the high-scoring sequences and 
     * annotated sequences showing the positions and p-values of all motif
       occurrences in each of the high-scoring sequences. 
 
 Each section of the results file contains an explanation of how to interpret
 them. 
 
   Match Scores
 
 The match score of a motif to a position in a sequence is the sum of the
 score from each column of the position-dependent scoring matrix
 corresponding to the letter at that position in the sequence. For example, if
 the sequence is 
 
 TAATGTTGGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGC
    ========
 
 and the motif is represented by the position-dependent scoring matrix (where
 each row of the matrix corresponds to a position in the motif) 
 
 =========|=================================
 POSITION |   A        C        G        T
 =========|=================================
   1      | 1.447    0.188   -4.025   -4.095 
   2      | 0.739    1.339   -3.945   -2.325 
   3      | 1.764   -3.562   -4.197   -3.895 
   4      | 1.574   -3.784   -1.594   -1.994 
   5      | 1.602   -3.935   -4.054   -1.370 
   6      | 0.797   -3.647   -0.814    0.215 
   7      |-1.280    1.873   -0.607   -1.933 
   8      |-3.076    1.035    1.414   -3.913 
 =========|=================================
 
 then the match score of the fourth position in the sequence (underlined)
 would be found by summing the score for T in position 1, G in position 2 and
 so on until G in position 8. So the match score would be 
 
   score = -4.095 + -3.945 + -3.895 + -1.994
           + -4.054 + -0.814 + -1.933 + 1.414 
         = -19.316
 
 The match scores for other positions in the sequence are calculated in the
 same way. Match scores are only calculated if the match completely fits within
 the sequence. Match scores are not calculated if the motif would overhang
 either end of the sequence. 
 
   P-values
 
 MAST reports all matches of a sequence to a motif or group of motifs in terms
 of the p-value of the match. MAST considers the p-values of four types of
 events: 
 
     position p-value: the match of a single position within a sequence to
     	a given motif, 
     sequence p-value: the best match of any position within a sequence
     	to a given motif, 
     combined p-value: the combined best matches of a sequence to a
     	group of motifs, and 
     E-value: observing a combined p-value at least as small in a random
     	database of the same size. 
 
 All p-values are based on a random sequence model that assumes each
 position in a random sequence is generated according to the average letter
 frequencies of all sequences in the the appropriate (peptide or nucleotide)
 non-redundant database (ftp://ncbi.nlm.nih.gov/blast/db/) on September 22,
 1996.  This can be overridden in two ways:
 
 	1) -bfile <bfile>
 	The random model uses the letter frequencies given in <bfile> 
 	instead of the non-redundant database frequencies.
 	The format of <bfile> is the same as that for the MEME -bfile opton; 
 	see the MEME documentation for details.  Sample files are given in 
 	directory tests: tests/nt.freq and tests/na.freq.) 
 	
 	2) -comp
 	The random model uses the letter frequencies in the current target
 	sequence instead of the non-redundant database frequencies.  This
 	causes p-values and E-values to be compensated individually for the 
 	actual composition of each sequence in the database.  This option
 	can increase search time substantially due to the need to compute
 	a different score distribution for each high-scoring sequence.
 
 
     Position p-value
 
     The p-value of a match of a given position within a sequence to a
     motif is defined as the probability of a randomly selected position in a
     randomly generated sequence having a match score at least as large
     as that of the given position. 
 
     Sequence p-value
 
     The p-value of a match of a sequence to a motif is defined as the
     probability of a randomly generated sequence of the same length
     having a match score at least as large as the largest match score of
     any position in the sequence. 
 
     Combined p-value
 
     The p-value of a match of a sequence to a group of motifs is defined
     as the probability of a randomly generated sequence of the same
     length having sequence p-values whose product is at least as small
     as the product of the sequence p-values of the matches of the motifs
     to the given sequence. 
 
     E-value
 
     The E-value of the match of a sequence in a database to a a group
     of motifs is defined as the expected number of sequences in a random
     database of the same size that would match the motifs as well as the
     sequence does and is equal to the combined p-value of the sequence
     times the number of sequences in the database. 
 
   High-scoring Sequences
 
 MAST lists the names and part of the descriptive text of all sequences
 whose E-value is less than E. Sequences shorter than one or more of the
 motifs are skipped. The sequences are sorted by increasing E-value. The
 value of E is set to 10 for the WEB server but is user-selectable in the
 down-loadable version of MAST. 
 
   Motif Diagrams
 
 Motif diagrams show the order and spacing of non-overlapping matches to
 the motifs in each high-scoring sequence. Motif occurrences are determined
 based on the position p-value of matches to the motif. Strong matches
 (p-value < M) are shown in square brackets (`[ ]'), weak matches (M <
 p-value < M