mast.ino_up800.oops

来自「EM算法的改进」· OOPS 代码 · 共 302 行

OOPS
302 行
字号
********************************************************************************MAST - Motif Alignment and Search Tool********************************************************************************	MAST version 3.5.1 (Release date: 2006/02/01 02:08:55)	For further information on how to interpret these results or to get	a copy of the MAST software please access http://meme.nbcr.net.****************************************************************************************************************************************************************REFERENCE********************************************************************************	If you use this program in your research, please cite:	Timothy L. Bailey and Michael Gribskov,	"Combining evidence using p-values: application to sequence homology	searches", Bioinformatics, 14(48-54), 1998.****************************************************************************************************************************************************************DATABASE AND MOTIFS********************************************************************************	DATABASE /home/meme/TEST/tests/INO_up800.s (nucleotide)	Last updated on Tue Jan 31 18:16:52 2006	Database contains 7 sequences, 5600 residues	Scores for positive and reverse complement strands are combined.	MOTIFS /home/meme/TEST/tests/meme.INO_up800.oops (nucleotide)	MOTIF WIDTH BEST POSSIBLE MATCH	----- ----- -------------------	  1    12   TTCACATGCCGC	  2    10   TCTGGCACAG	PAIRWISE MOTIF CORRELATIONS:	MOTIF     1	----- -----	   2   0.32	No overly similar pairs (correlation > 0.60) found.	Random model letter frequencies (from non-redundant database):	A 0.281 C 0.222 G 0.229 T 0.267 ****************************************************************************************************************************************************************SECTION I: HIGH-SCORING SEQUENCES********************************************************************************	- Each of the following 7 sequences has E-value less than 10.	- The E-value of a sequence is the expected number of sequences	  in a random database of the same size that would match the motifs as	  well as the sequence does and is equal to the combined p-value of the	  sequence times the number of sequences in the database.	- The combined p-value of a sequence measures the strength of the	  match of the sequence to all the motifs and is calculated by	    o finding the score of the single best match of each motif	      to the sequence (best matches may overlap),	    o calculating the sequence p-value of each score,	    o forming the product of the p-values,	    o taking the p-value of the product.	- The sequence p-value of a score is defined as the	  probability of a random sequence of the same length containing	  some match with as good or better a score.	- The score for the match of a position in a sequence to a motif	  is computed by by summing the appropriate entry from each column of	  the position-dependent scoring matrix that represents the motif.	- Sequences shorter than one or more of the motifs are skipped.	- The table is sorted by increasing E-value.********************************************************************************SEQUENCE NAME                      DESCRIPTION                   E-VALUE  LENGTH-------------                      -----------                   -------- ------ACC1                               sequence of the region up...    6.1e-05    800CHO1                               sequence of the region up...    0.00016    800INO1                               sequence of the region up...    0.00019    800FAS1                               sequence of the region up...    0.00022    800OPI3                               sequence of the region up...    0.00092    800CHO2                               sequence of the region up...     0.0029    800FAS2                               sequence of the region up...     0.0093    800****************************************************************************************************************************************************************SECTION II: MOTIF DIAGRAMS********************************************************************************	- The ordering and spacing of all non-overlapping motif occurrences	  are shown for each high-scoring sequence listed in Section I.	- A motif occurrence is defined as a position in the sequence whose	  match to the motif has POSITION p-value less than 0.0001.	- The POSITION p-value of a match is the probability of	  a single random subsequence of the length of the motif	  scoring at least as well as the observed match.	- For each sequence, all motif occurrences are shown unless there	  are overlaps.  In that case, a motif occurrence is shown only if its	  p-value is less than the product of the p-values of the other	  (lower-numbered) motif occurrences that it overlaps.	- The table also shows the E-value of each sequence.	- Spacers and motif occurences are indicated by	   o -d-    `d' residues separate the end of the preceding motif 		    occurrence and the start of the following motif occurrence	   o [sn]  occurrence of motif `n' with p-value less than 0.0001.		    A minus sign indicates that the occurrence is on the		    reverse complement strand.********************************************************************************SEQUENCE NAME                      E-VALUE   MOTIF DIAGRAM-------------                      --------  -------------ACC1                                6.1e-05  82_[+1]_137_[+2]_559CHO1                                0.00016  152_[+2]_396_[-2]_42_[+1]_17_                                             [+1]_149INO1                                0.00019  282_[-2]_327_[-1]_55_[+1]_102FAS1                                0.00022  43_[+2]_41_[+1]_694OPI3                                0.00092  185_[-2]_144_[+1]_449CHO2                                 0.0029  353_[+1]_47_[-2]_378FAS2                                 0.0093  184_[-2]_372_[+1]_222****************************************************************************************************************************************************************SECTION III: ANNOTATED SEQUENCES********************************************************************************	- The positions and p-values of the non-overlapping motif occurrences	  are shown above the actual sequence for each of the high-scoring	  sequences from Section I.	- A motif occurrence is defined as a position in the sequence whose	  match to the motif has POSITION p-value less than 0.0001 as 	  defined in Section II.	- For each sequence, the first line specifies the name of the sequence.	- The second (and possibly more) lines give a description of the 	  sequence.	- Following the description line(s) is a line giving the length, 	  combined p-value, and E-value of the sequence as defined in Section I.	- The next line reproduces the motif diagram from Section II.	- The entire sequence is printed on the following lines.	- Motif occurrences are indicated directly above their positions in the	  sequence on lines showing	   o the motif number of the occurrence (a minus sign indicates that	  the occurrence is on the reverse complement strand),	   o the position p-value of the occurrence,	   o the best possible match to the motif (or its reverse complement), and	   o columns whose match to the motif has a positive score (indicated 	     by a plus sign).********************************************************************************ACC1  sequence of the region upstream from YNR016C  LENGTH = 800  COMBINED P-VALUE = 8.78e-06  E-VALUE =  6.1e-05  DIAGRAM: 82_[+1]_137_[+2]_559            [+1]            3.1e-07            TTCACATGCCGC            ++++++++++ +76   TAAAATCTTCACATGGCCCGGCCGCGCGCGCGTTGTGCCAACAAGTCGCAGTCGAAATTCAACCGCTCATTGCCA           [+2]           7.4e-07           TCTGGCACAG           ++++++++++226  TCGTATTCTGGCACAGTATAGCCTAGCACAATCACTGTCACAATTGTTATCGGTTCTACAATTGTTCTGCTCTCTCHO1  sequence of the region upstream from YER026C  LENGTH = 800  COMBINED P-VALUE = 2.30e-05  E-VALUE =  0.00016  DIAGRAM: 152_[+2]_396_[-2]_42_[+1]_17_[+1]_149       [+2]       3.9e-05       TCTGGCACAG       ++++++ +151  CGTCTGGCGCCCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAATACAT                                      [-2]                                      7.4e-07                                      CTGTGCCAGA                                      ++++++++++526  CAATCCCCACTCCTTCTCAATGTGTGCAGACTTCTGTGCCAGACACTGAATATATATCAGTAATTGGTCAAAATC               [+1]                         [+1]               8.7e-07                      2.2e-05               TTCACATGCCGC                 TTCACATGCCGC               ++++++ +++ +                 +++++++++  +601  ACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTTTCACATGGACCCATCTAAAGATGAAGATCCGTATTINO1  sequence of the region upstream from YJL153C  LENGTH = 800  COMBINED P-VALUE = 2.71e-05  E-VALUE =  0.00019  DIAGRAM: 282_[-2]_327_[-1]_55_[+1]_102                                                              [-2]                                                              1.8e-05                                                              CTGTGCCAGA                                                              +++ +++ ++226  ACGTTGTATATGAAACGAGTAGTGAACGTTCGTACGATCTTTCACGCAGACATGCGACTGCGCCCGCCGTAGACC                        [-1]                        4.2e-08                        GCGGCATGTGAA                        ++++++++++++601  TGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTTTATCTTCATCCTTCTTTCCCAGAATATTG                [+1]                1.3e-05                TTCACATGCCGC                +++++++++ ++676  AACTTATTTAATTCACATGGAGCAGAGAAAGCGCACCTCTGCGTTGGCGGCAATGTTAATTTGAGACGTATATAAFAS1  sequence of the region upstream from YKL182W  LENGTH = 800  COMBINED P-VALUE = 3.19e-05  E-VALUE =  0.00022  DIAGRAM: 43_[+2]_41_[+1]_694                                                [+2]                                                2.2e-05                                                TCTGGCACAG                                                ++ +++++ +1    CCGGGTTATAGCAGCGTCTGCTCCGCATCACGATACACGAGGTGCAGGCACGGTTCACTACTCCCCTGGCCTCCA                        [+1]                        4.2e-08                        TTCACATGCCGC                        ++++++++++++76   ACAAACGACGGCCAAAAACTTCACATGCCGCCCAGCCAAGCATAATTACGCAACAGCGATCTTTCCGTCGCACAAOPI3  sequence of the region upstream from YJR073C  LENGTH = 800  COMBINED P-VALUE = 1.32e-04  E-VALUE =  0.00092  DIAGRAM: 185_[-2]_144_[+1]_449                                        [-2]                                        7.4e-07                                        CTGTGCCAGA                                        ++++++++++151  GTTAATCTGATCAACGCTACGCCGATGACAACGGTCTGTGCCAGATCTGGTTTTCCCCACTTATTTGCTACTTCC                                            [+1]                                            5.8e-06                                            TTCACATGCCGC                                            ++++ ++ ++ +301  AACTCCGTCAGGTCTTCCACGTGGAACTGCCAAGCCTCCTTCAGATCGCTCTTGTCGACCGTCTCCAAGAGATCCCHO2  sequence of the region upstream from YGR157W  LENGTH = 800  COMBINED P-VALUE = 4.18e-04  E-VALUE =   0.0029  DIAGRAM: 353_[+1]_47_[-2]_378                                                          [+1]                                                          5.2e-07                                                          TTCACATGCCGC                                                          +++ ++++++++301  ATATATATTTTTGCCTTGGTTTAAATTGGTCAAGACAGTCAATTGCCACACTTTTCTCATGCCGCATTCATTATT                                          [-2]                                          2.9e-05                                          CTGTGCCAGA                                          +  +++++++376  CGCGAAGTTTTCCACACAAAACTGTGAAAATGAACGGCGATGCCAGAAACGGCAAAACCTCAAATGTTAGATAACFAS2  sequence of the region upstream from YPL231W  LENGTH = 800  COMBINED P-VALUE = 1.33e-03  E-VALUE =   0.0093  DIAGRAM: 184_[-2]_372_[+1]_222                                       [-2]                                       2.9e-05                                       CTGTGCCAGA                                         ++++++++151  AACAGGGTGTCGGTCATACCGATAAAGCCGTCAAGAGTGCCAGAAAAGCAAGAAAGAACAAGATTAGATGTTGGT                                              [+1]                                              1.9e-06                                              TTCACATGCCGC                                              +++++++++  +526  GCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCTCATTCGCCTCGTAACGTTAC********************************************************************************CPU: rocks-155.sdsc.eduTime 0.006998 secs.mast meme.INO_up800.oops

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?