mast.crp0.zoops

来自「EM算法的改进」· ZOOPS 代码 · 共 434 行 · 第 1/2 页

ZOOPS
434 行
字号
********************************************************************************MAST - Motif Alignment and Search Tool********************************************************************************	MAST version 3.5.3 (Release date: 2006-03-08 09:30:25 +1000 (Wed, 08 Mar 2006))	For further information on how to interpret these results or to get	a copy of the MAST software please access http://meme.nbcr.net.****************************************************************************************************************************************************************REFERENCE********************************************************************************	If you use this program in your research, please cite:	Timothy L. Bailey and Michael Gribskov,	"Combining evidence using p-values: application to sequence homology	searches", Bioinformatics, 14(48-54), 1998.****************************************************************************************************************************************************************DATABASE AND MOTIFS********************************************************************************	DATABASE /home/tbailey/meme_trunk/scripts/../tests/crp0.s (nucleotide)	Last updated on Mon May 29 14:53:46 2006	Database contains 18 sequences, 1890 residues	Scores for positive and reverse complement strands are combined.	MOTIFS /home/tbailey/meme_trunk/scripts/../tests/meme.crp0.zoops (nucleotide)	MOTIF WIDTH BEST POSSIBLE MATCH	----- ----- -------------------	  1    19   TGTGAGCGAGGTCACACTT	  2     8   CGGCGGGG	PAIRWISE MOTIF CORRELATIONS:	MOTIF     1	----- -----	   2   0.33	No overly similar pairs (correlation > 0.60) found.	Random model letter frequencies (from non-redundant database):	A 0.281 C 0.222 G 0.229 T 0.267 ****************************************************************************************************************************************************************SECTION I: HIGH-SCORING SEQUENCES********************************************************************************	- Each of the following 18 sequences has E-value less than 10.	- The E-value of a sequence is the expected number of sequences	  in a random database of the same size that would match the motifs as	  well as the sequence does and is equal to the combined p-value of the	  sequence times the number of sequences in the database.	- The combined p-value of a sequence measures the strength of the	  match of the sequence to all the motifs and is calculated by	    o finding the score of the single best match of each motif	      to the sequence (best matches may overlap),	    o calculating the sequence p-value of each score,	    o forming the product of the p-values,	    o taking the p-value of the product.	- The sequence p-value of a score is defined as the	  probability of a random sequence of the same length containing	  some match with as good or better a score.	- The score for the match of a position in a sequence to a motif	  is computed by by summing the appropriate entry from each column of	  the position-dependent scoring matrix that represents the motif.	- Sequences shorter than one or more of the motifs are skipped.	- The table is sorted by increasing E-value.********************************************************************************SEQUENCE NAME                      DESCRIPTION                   E-VALUE  LENGTH-------------                      -----------                   -------- ------male                               14                             0.00048    105ilv                                39                              0.0014    105ara                                17 55                           0.0014    105ompa                               48                               0.014    105ce1cg                              17 61                            0.026    105malt                               41                               0.037    105gale                               42                               0.038    105bglr1                              76                               0.046    105crp                                63                               0.054    105deop2                              7 60                              0.06    105pbr322                             53                               0.075    105cya                                50                               0.077    105tnaa                               71                               0.081    105lac                                9 80                              0.12    105tdc                                78                                0.24    105uxu1                               17                                0.34    105malk                               29 61                             0.35    105trn9cat                            1 84                              0.48    105****************************************************************************************************************************************************************SECTION II: MOTIF DIAGRAMS********************************************************************************	- The ordering and spacing of all non-overlapping motif occurrences	  are shown for each high-scoring sequence listed in Section I.	- A motif occurrence is defined as a position in the sequence whose	  match to the motif has POSITION p-value less than 0.0001.	- The POSITION p-value of a match is the probability of	  a single random subsequence of the length of the motif	  scoring at least as well as the observed match.	- For each sequence, all motif occurrences are shown unless there	  are overlaps.  In that case, a motif occurrence is shown only if its	  p-value is less than the product of the p-values of the other	  (lower-numbered) motif occurrences that it overlaps.	- The table also shows the E-value of each sequence.	- Spacers and motif occurences are indicated by	   o -d-    `d' residues separate the end of the preceding motif 		    occurrence and the start of the following motif occurrence	   o [sn]  occurrence of motif `n' with p-value less than 0.0001.		    A minus sign indicates that the occurrence is on the		    reverse complement strand.********************************************************************************SEQUENCE NAME                      E-VALUE   MOTIF DIAGRAM-------------                      --------  -------------male                                0.00048  16_[+1]_5_[+2]_57ilv                                  0.0014  4_[+2]_29_[+1]_45ara                                  0.0014  57_[+1]_29ompa                                  0.014  50_[+1]_36ce1cg                                 0.026  16_[-1]_28_[+1]_23malt                                  0.037  40_[-1]_46gale                                  0.038  44_[+1]_42bglr1                                 0.046  78_[+1]_8crp                                   0.054  65_[+1]_21deop2                                  0.06  9_[+1]_31_[-1]_27pbr322                                0.075  52_[-1]_34cya                                   0.077  49_[-1]_37tnaa                                  0.081  73_[+1]_13lac                                    0.12  11_[+1]_75tdc                                    0.24  78_[+1]_8uxu1                                   0.34  19_[+1]_67malk                                   0.35  60_[-1]_26trn9cat                                0.48  83_[-1]_3****************************************************************************************************************************************************************SECTION III: ANNOTATED SEQUENCES********************************************************************************	- The positions and p-values of the non-overlapping motif occurrences	  are shown above the actual sequence for each of the high-scoring	  sequences from Section I.	- A motif occurrence is defined as a position in the sequence whose	  match to the motif has POSITION p-value less than 0.0001 as 	  defined in Section II.	- For each sequence, the first line specifies the name of the sequence.	- The second (and possibly more) lines give a description of the 	  sequence.	- Following the description line(s) is a line giving the length, 	  combined p-value, and E-value of the sequence as defined in Section I.	- The next line reproduces the motif diagram from Section II.	- The entire sequence is printed on the following lines.	- Motif occurrences are indicated directly above their positions in the	  sequence on lines showing	   o the motif number of the occurrence (a minus sign indicates that	  the occurrence is on the reverse complement strand),	   o the position p-value of the occurrence,	   o the best possible match to the motif (or its reverse complement), and	   o columns whose match to the motif has a positive score (indicated 	     by a plus sign).********************************************************************************male  14  LENGTH = 105  COMBINED P-VALUE = 2.66e-05  E-VALUE =  0.00048  DIAGRAM: 16_[+1]_5_[+2]_57                     [+1]                    [+2]                     3.6e-06                 1.5e-05                     TGTGAGCGAGGTCACACTT     CGGCGGGG                     +++ +  +++ ++++++++     ++++++++1    ACATTACCGCCAATTCTGTAACAGAGATCACACAAAGCGACGGTGGGGCGTAGGGGCAAGGAGGATGGAAAGAGGilv  39  LENGTH = 105  COMBINED P-VALUE = 7.52e-05  E-VALUE =   0.0014  DIAGRAM: 4_[+2]_29_[+1]_45         [+2]                                 [+1]         7.0e-06                              2.4e-05         CGGCGGGG                             TGTGAGCGAGGTCACACTT         ++++++++                              ++++++ ++  + ++ ++1    GCTCCGGCGGGGTTTTTTGTTATCTGCAATTCAGTACAAAACGTGATCAACCCCTCAATTTTCCCTTTGCTGAAAara  17 55  LENGTH = 105  COMBINED P-VALUE = 7.91e-05  E-VALUE =   0.0014  DIAGRAM: 57_[+1]_29                                                              [+1]                                                              3.6e-08                                                              TGTGAGCGAGGTCACACT                                                              ++++  ++++++++++++1    GACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACT               T     +76   TTGCTATGCCATAGCATTTTTATCCATAAGompa  48  LENGTH = 105  COMBINED P-VALUE = 7.52e-04  E-VALUE =    0.014

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?