mast.ino_up800.tcm

来自「EM算法的改进」· TCM 代码 · 共 326 行

TCM
326 行
字号
********************************************************************************MAST - Motif Alignment and Search Tool********************************************************************************	MAST version 3.5.1 (Release date: 2006/02/01 02:08:55)	For further information on how to interpret these results or to get	a copy of the MAST software please access http://meme.nbcr.net.****************************************************************************************************************************************************************REFERENCE********************************************************************************	If you use this program in your research, please cite:	Timothy L. Bailey and Michael Gribskov,	"Combining evidence using p-values: application to sequence homology	searches", Bioinformatics, 14(48-54), 1998.****************************************************************************************************************************************************************DATABASE AND MOTIFS********************************************************************************	DATABASE /home/meme/TEST/tests/INO_up800.s (nucleotide)	Last updated on Tue Jan 31 18:16:52 2006	Database contains 7 sequences, 5600 residues	Scores for positive and reverse complement strands are combined.	MOTIFS /home/meme/TEST/tests/meme.INO_up800.tcm (nucleotide)	MOTIF WIDTH BEST POSSIBLE MATCH	----- ----- -------------------	  1    15   TTCACATGCCGCCCC	  2    21   GGCCACATCGCCACTGGCGGC	PAIRWISE MOTIF CORRELATIONS:	MOTIF     1	----- -----	   2   0.27	No overly similar pairs (correlation > 0.60) found.	Random model letter frequencies (from non-redundant database):	A 0.281 C 0.222 G 0.229 T 0.267 ****************************************************************************************************************************************************************SECTION I: HIGH-SCORING SEQUENCES********************************************************************************	- Each of the following 7 sequences has E-value less than 10.	- The E-value of a sequence is the expected number of sequences	  in a random database of the same size that would match the motifs as	  well as the sequence does and is equal to the combined p-value of the	  sequence times the number of sequences in the database.	- The combined p-value of a sequence measures the strength of the	  match of the sequence to all the motifs and is calculated by	    o finding the score of the single best match of each motif	      to the sequence (best matches may overlap),	    o calculating the sequence p-value of each score,	    o forming the product of the p-values,	    o taking the p-value of the product.	- The sequence p-value of a score is defined as the	  probability of a random sequence of the same length containing	  some match with as good or better a score.	- The score for the match of a position in a sequence to a motif	  is computed by by summing the appropriate entry from each column of	  the position-dependent scoring matrix that represents the motif.	- Sequences shorter than one or more of the motifs are skipped.	- The table is sorted by increasing E-value.********************************************************************************SEQUENCE NAME                      DESCRIPTION                   E-VALUE  LENGTH-------------                      -----------                   -------- ------INO1                               sequence of the region up...    4.4e-09    800FAS2                               sequence of the region up...    5.2e-07    800FAS1                               sequence of the region up...    1.1e-06    800OPI3                               sequence of the region up...    1.5e-05    800ACC1                               sequence of the region up...    5.8e-05    800CHO1                               sequence of the region up...      0.023    800CHO2                               sequence of the region up...      0.094    800****************************************************************************************************************************************************************SECTION II: MOTIF DIAGRAMS********************************************************************************	- The ordering and spacing of all non-overlapping motif occurrences	  are shown for each high-scoring sequence listed in Section I.	- A motif occurrence is defined as a position in the sequence whose	  match to the motif has POSITION p-value less than 0.0001.	- The POSITION p-value of a match is the probability of	  a single random subsequence of the length of the motif	  scoring at least as well as the observed match.	- For each sequence, all motif occurrences are shown unless there	  are overlaps.  In that case, a motif occurrence is shown only if its	  p-value is less than the product of the p-values of the other	  (lower-numbered) motif occurrences that it overlaps.	- The table also shows the E-value of each sequence.	- Spacers and motif occurences are indicated by	   o -d-    `d' residues separate the end of the preceding motif 		    occurrence and the start of the following motif occurrence	   o [sn]  occurrence of motif `n' with p-value less than 0.0001.		    A minus sign indicates that the occurrence is on the		    reverse complement strand.********************************************************************************SEQUENCE NAME                      E-VALUE   MOTIF DIAGRAM-------------                      --------  -------------INO1                                4.4e-09  365_[-2]_160_[-1]_6_[-1]_34_[-1]_                                             55_[+1]_4_[+2]_74FAS2                                5.2e-07  566_[+1]_131_[+2]_67FAS1                                1.1e-06  52_[+2]_21_[+1]_691OPI3                                1.5e-05  291_[+2]_41_[-2]_126_[-2]_60_                                             [-1]_40_[+1]_149ACC1                                5.8e-05  52_[-2]_9_[+1]_703CHO1                                  0.023  162_[+1]_433_[+1]_14_[+1]_146CHO2                                  0.094  353_[+1]_109_[-1]_308****************************************************************************************************************************************************************SECTION III: ANNOTATED SEQUENCES********************************************************************************	- The positions and p-values of the non-overlapping motif occurrences	  are shown above the actual sequence for each of the high-scoring	  sequences from Section I.	- A motif occurrence is defined as a position in the sequence whose	  match to the motif has POSITION p-value less than 0.0001 as 	  defined in Section II.	- For each sequence, the first line specifies the name of the sequence.	- The second (and possibly more) lines give a description of the 	  sequence.	- Following the description line(s) is a line giving the length, 	  combined p-value, and E-value of the sequence as defined in Section I.	- The next line reproduces the motif diagram from Section II.	- The entire sequence is printed on the following lines.	- Motif occurrences are indicated directly above their positions in the	  sequence on lines showing	   o the motif number of the occurrence (a minus sign indicates that	  the occurrence is on the reverse complement strand),	   o the position p-value of the occurrence,	   o the best possible match to the motif (or its reverse complement), and	   o columns whose match to the motif has a positive score (indicated 	     by a plus sign).********************************************************************************INO1  sequence of the region upstream from YJL153C  LENGTH = 800  COMBINED P-VALUE = 6.30e-10  E-VALUE =  4.4e-09  DIAGRAM: 365_[-2]_160_[-1]_6_[-1]_34_[-1]_55_[+1]_4_[+2]_74                                                                      [-2]                                                                      1.5e-10                                                                      GCCGCCAGTG                                                                      ++++++++++301  GTGACCTGGAAGCTCACCCTGCAGAGGAATCTCAAGCACAGCCTCCAGCATATGATGAAGACGATGAGGCCGGTG               GCGATGTGGCC     +++++++++++376  CCGATGTGCCCTTGATGGACAACAAACAACAGCTCTCTTCCGGCCGTACTTAGTGATCGGAACGAGCTCTTTATC                          [-1]                 [-1]                          5.3e-06              1.7e-06                          GGGGCGGCATGTGAA      GGGGCGGCATGTGAA                          +++++++ +++ + +      +++++++ +++++++526  TGAAATACGTGCCGGTGTTCCGGGGTTGGATGCGGAATCGAAAGTGTTGAATGTGAAATATGCGGAGGCCAAGTA                     [-1]                     6.6e-08                     GGGGCGGCATGTGAA                     +++++++++++++++601  TGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTTTATCTTCATCCTTCTTTCCCAGAATATTG                [+1]               [+2]                2.1e-06            2.1e-07                TTCACATGCCGCCCC    GGCCACATCGCCACTGGCGGC                +++++++++++++      + ++++ ++ ++  +++++++676  AACTTATTTAATTCACATGGAGCAGAGAAAGCGCACCTCTGCGTTGGCGGCAATGTTAATTTGAGACGTATATAAFAS2  sequence of the region upstream from YPL231W  LENGTH = 800  COMBINED P-VALUE = 7.49e-08  E-VALUE =  5.2e-07  DIAGRAM: 566_[+1]_131_[+2]_67                                              [+1]                                              4.0e-07                                              TTCACATGCCGCCCC                                              +++++++++ +++++526  GCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCTCATTCGCCTCGTAACGTTAC                                          [+2]                                          3.7e-09                                          GGCCACATCGCCACTGGCGGC                                          + +++++++++++++++++++676  TGCCTCATATATAACTTGTTAACTGAAGGTTACACAAGACCACATCACCACTGTCGTGCTTTTCTAATAACCGCTFAS1  sequence of the region upstream from YKL182W  LENGTH = 800  COMBINED P-VALUE = 1.51e-07  E-VALUE =  1.1e-06  DIAGRAM: 52_[+2]_21_[+1]_691                                                         [+2]                                                         1.8e-07                                                         GGCCACATCGCCACTGGCGGC                                                         +  ++++ + ++ ++++++++1    CCGGGTTATAGCAGCGTCTGCTCCGCATCACGATACACGAGGTGCAGGCACGGTTCACTACTCCCCTGGCCTCCA                        [+1]                        1.7e-08                        TTCACATGCCGCCCC                        ++++++++++++++76   ACAAACGACGGCCAAAAACTTCACATGCCGCCCAGCCAAGCATAATTACGCAACAGCGATCTTTCCGTCGCACAAOPI3  sequence of the region upstream from YJR073C  LENGTH = 800  COMBINED P-VALUE = 2.07e-06  E-VALUE =  1.5e-05  DIAGRAM: 291_[+2]_41_[-2]_126_[-2]_60_[-1]_40_[+1]_149                                                                       [+2]                                                                       9.1e-07                                                                       GGCCACATC                                                                       + +++ +++226  ATAACGAGTCCGGTGAACTTGGTTCCTTGCTGAACAGTGTCTTCTTGTAAAGCTTCCCATTTGGTGGTCCCGTTC                                                          [-2]                                                          1.7e-06     GCCACTGGCGGC                                         GCCGCCAGTGGCGATGTGGCC     +++ +++++ ++                                         + +++++++ ++ +++ +  +301  AACTCCGTCAGGTCTTCCACGTGGAACTGCCAAGCCTCCTTCAGATCGCTCTTGTCGACCGTCTCCAAGAGATCC                                                       [-2]                                                       2.5e-08                                                       GCCGCCAGTGGCGATGTGGCC                                                       +++++++++ +++++++ +++451  TGTGTATCGGGGACTTCTCTTAGAGTAGAAGCGTCTATAAACCCAGGTGGGACGACAGTAGTGATGGCGCCGCCG                                                             [-1]                                                             3.4e-06                                                             GGGGCGGCATGTGAA                                                             +++ +++++++++ +526  TATAATTCGACTTCCTTGTTGTTCATGCTTCCTTGATGACCAGGGTAGGTGTCAATGAGAGTGCATGTGGAAAGT                                         [+1]                                         2.0e-06                                         TTCACATGCCGCCCC                                         ++++ ++++++ +++601  TGCACCGGTTGTGAAATATGAGAAGCCTTTTCAATCTTCATATGCAAACCCACACATGCATCGTTGGTTTCTGTCACC1  sequence of the region upstream from YNR016C  LENGTH = 800  COMBINED P-VALUE = 8.22e-06  E-VALUE =  5.8e-05  DIAGRAM: 52_[-2]_9_[+1]_703                                                         [-2]                                                         2.5e-07                                                         GCCGCCAGTGGCGATGTGGCC                                                         +++ ++++  +++ ++ ++++1    TATCCAAAGGGGAATGCTTCATCTTGTTGAACAACGCCCAACAATTTCCACTGCCCACCGAATCGTTGCGCCCGT            [+1]            8.8e-07            TTCACATGCCGCCCC            ++++++++++++  +76   TAAAATCTTCACATGGCCCGGCCGCGCGCGCGTTGTGCCAACAAGTCGCAGTCGAAATTCAACCGCTCATTGCCACHO1  sequence of the region upstream from YER026C  LENGTH = 800  COMBINED P-VALUE = 3.22e-03  E-VALUE =    0.023  DIAGRAM: 162_[+1]_433_[+1]_14_[+1]_146                 [+1]                 6.4e-06                 TTCACATGCCGCCCC                 +++ +++ +++ +++151  CGTCTGGCGCCCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAATACAT               [+1]                         [+1]               4.5e-07                      1.5e-06               TTCACATGCCGCCCC              TTCACATGCCGCCCC               ++++++ ++++++++              +++++++++++++ +601  ACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTTTCACATGGACCCATCTAAAGATGAAGATCCGTATTCHO2  sequence of the region upstream from YGR157W  LENGTH = 800  COMBINED P-VALUE = 1.35e-02  E-VALUE =    0.094  DIAGRAM: 353_[+1]_109_[-1]_308                                                          [+1]                                                          1.2e-06                                                          TTCACATGCCGCCCC                                                          +++ +++++++++++301  ATATATATTTTTGCCTTGGTTTAAATTGGTCAAGACAGTCAATTGCCACACTTTTCTCATGCCGCATTCATTATT                                [-1]                                1.2e-05                                GGGGCGGCATGTGAA                                +++  +++++ ++++451  GTGGATCTCCGACACATGTGAATTTATAAGTAGGCATATGAAAATACAGATTCTTTCCACTGTGTTCCCTTTTAT********************************************************************************CPU: rocks-155.sdsc.eduTime 0.011998 secs.mast meme.INO_up800.tcm

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?