📄 mast.ino_up800.tcm
字号:
********************************************************************************MAST - Motif Alignment and Search Tool******************************************************************************** MAST version 3.5.1 (Release date: 2006/02/01 02:08:55) For further information on how to interpret these results or to get a copy of the MAST software please access http://meme.nbcr.net.****************************************************************************************************************************************************************REFERENCE******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Michael Gribskov, "Combining evidence using p-values: application to sequence homology searches", Bioinformatics, 14(48-54), 1998.****************************************************************************************************************************************************************DATABASE AND MOTIFS******************************************************************************** DATABASE /home/meme/TEST/tests/INO_up800.s (nucleotide) Last updated on Tue Jan 31 18:16:52 2006 Database contains 7 sequences, 5600 residues Scores for positive and reverse complement strands are combined. MOTIFS /home/meme/TEST/tests/meme.INO_up800.tcm (nucleotide) MOTIF WIDTH BEST POSSIBLE MATCH ----- ----- ------------------- 1 15 TTCACATGCCGCCCC 2 21 GGCCACATCGCCACTGGCGGC PAIRWISE MOTIF CORRELATIONS: MOTIF 1 ----- ----- 2 0.27 No overly similar pairs (correlation > 0.60) found. Random model letter frequencies (from non-redundant database): A 0.281 C 0.222 G 0.229 T 0.267 ****************************************************************************************************************************************************************SECTION I: HIGH-SCORING SEQUENCES******************************************************************************** - Each of the following 7 sequences has E-value less than 10. - The E-value of a sequence is the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database. - The combined p-value of a sequence measures the strength of the match of the sequence to all the motifs and is calculated by o finding the score of the single best match of each motif to the sequence (best matches may overlap), o calculating the sequence p-value of each score, o forming the product of the p-values, o taking the p-value of the product. - The sequence p-value of a score is defined as the probability of a random sequence of the same length containing some match with as good or better a score. - The score for the match of a position in a sequence to a motif is computed by by summing the appropriate entry from each column of the position-dependent scoring matrix that represents the motif. - Sequences shorter than one or more of the motifs are skipped. - The table is sorted by increasing E-value.********************************************************************************SEQUENCE NAME DESCRIPTION E-VALUE LENGTH------------- ----------- -------- ------INO1 sequence of the region up... 4.4e-09 800FAS2 sequence of the region up... 5.2e-07 800FAS1 sequence of the region up... 1.1e-06 800OPI3 sequence of the region up... 1.5e-05 800ACC1 sequence of the region up... 5.8e-05 800CHO1 sequence of the region up... 0.023 800CHO2 sequence of the region up... 0.094 800****************************************************************************************************************************************************************SECTION II: MOTIF DIAGRAMS******************************************************************************** - The ordering and spacing of all non-overlapping motif occurrences are shown for each high-scoring sequence listed in Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001. - The POSITION p-value of a match is the probability of a single random subsequence of the length of the motif scoring at least as well as the observed match. - For each sequence, all motif occurrences are shown unless there are overlaps. In that case, a motif occurrence is shown only if its p-value is less than the product of the p-values of the other (lower-numbered) motif occurrences that it overlaps. - The table also shows the E-value of each sequence. - Spacers and motif occurences are indicated by o -d- `d' residues separate the end of the preceding motif occurrence and the start of the following motif occurrence o [sn] occurrence of motif `n' with p-value less than 0.0001. A minus sign indicates that the occurrence is on the reverse complement strand.********************************************************************************SEQUENCE NAME E-VALUE MOTIF DIAGRAM------------- -------- -------------INO1 4.4e-09 365_[-2]_160_[-1]_6_[-1]_34_[-1]_ 55_[+1]_4_[+2]_74FAS2 5.2e-07 566_[+1]_131_[+2]_67FAS1 1.1e-06 52_[+2]_21_[+1]_691OPI3 1.5e-05 291_[+2]_41_[-2]_126_[-2]_60_ [-1]_40_[+1]_149ACC1 5.8e-05 52_[-2]_9_[+1]_703CHO1 0.023 162_[+1]_433_[+1]_14_[+1]_146CHO2 0.094 353_[+1]_109_[-1]_308****************************************************************************************************************************************************************SECTION III: ANNOTATED SEQUENCES******************************************************************************** - The positions and p-values of the non-overlapping motif occurrences are shown above the actual sequence for each of the high-scoring sequences from Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001 as defined in Section II. - For each sequence, the first line specifies the name of the sequence. - The second (and possibly more) lines give a description of the sequence. - Following the description line(s) is a line giving the length, combined p-value, and E-value of the sequence as defined in Section I. - The next line reproduces the motif diagram from Section II. - The entire sequence is printed on the following lines. - Motif occurrences are indicated directly above their positions in the sequence on lines showing o the motif number of the occurrence (a minus sign indicates that the occurrence is on the reverse complement strand), o the position p-value of the occurrence, o the best possible match to the motif (or its reverse complement), and o columns whose match to the motif has a positive score (indicated by a plus sign).********************************************************************************INO1 sequence of the region upstream from YJL153C LENGTH = 800 COMBINED P-VALUE = 6.30e-10 E-VALUE = 4.4e-09 DIAGRAM: 365_[-2]_160_[-1]_6_[-1]_34_[-1]_55_[+1]_4_[+2]_74 [-2] 1.5e-10 GCCGCCAGTG ++++++++++301 GTGACCTGGAAGCTCACCCTGCAGAGGAATCTCAAGCACAGCCTCCAGCATATGATGAAGACGATGAGGCCGGTG GCGATGTGGCC +++++++++++376 CCGATGTGCCCTTGATGGACAACAAACAACAGCTCTCTTCCGGCCGTACTTAGTGATCGGAACGAGCTCTTTATC [-1] [-1] 5.3e-06 1.7e-06 GGGGCGGCATGTGAA GGGGCGGCATGTGAA +++++++ +++ + + +++++++ +++++++526 TGAAATACGTGCCGGTGTTCCGGGGTTGGATGCGGAATCGAAAGTGTTGAATGTGAAATATGCGGAGGCCAAGTA [-1] 6.6e-08 GGGGCGGCATGTGAA +++++++++++++++601 TGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTTTATCTTCATCCTTCTTTCCCAGAATATTG [+1] [+2] 2.1e-06 2.1e-07 TTCACATGCCGCCCC GGCCACATCGCCACTGGCGGC +++++++++++++ + ++++ ++ ++ +++++++676 AACTTATTTAATTCACATGGAGCAGAGAAAGCGCACCTCTGCGTTGGCGGCAATGTTAATTTGAGACGTATATAAFAS2 sequence of the region upstream from YPL231W LENGTH = 800 COMBINED P-VALUE = 7.49e-08 E-VALUE = 5.2e-07 DIAGRAM: 566_[+1]_131_[+2]_67 [+1] 4.0e-07 TTCACATGCCGCCCC +++++++++ +++++526 GCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCTCATTCGCCTCGTAACGTTAC [+2] 3.7e-09 GGCCACATCGCCACTGGCGGC + +++++++++++++++++++676 TGCCTCATATATAACTTGTTAACTGAAGGTTACACAAGACCACATCACCACTGTCGTGCTTTTCTAATAACCGCTFAS1 sequence of the region upstream from YKL182W LENGTH = 800 COMBINED P-VALUE = 1.51e-07 E-VALUE = 1.1e-06 DIAGRAM: 52_[+2]_21_[+1]_691 [+2] 1.8e-07 GGCCACATCGCCACTGGCGGC + ++++ + ++ ++++++++1 CCGGGTTATAGCAGCGTCTGCTCCGCATCACGATACACGAGGTGCAGGCACGGTTCACTACTCCCCTGGCCTCCA [+1] 1.7e-08 TTCACATGCCGCCCC ++++++++++++++76 ACAAACGACGGCCAAAAACTTCACATGCCGCCCAGCCAAGCATAATTACGCAACAGCGATCTTTCCGTCGCACAAOPI3 sequence of the region upstream from YJR073C LENGTH = 800 COMBINED P-VALUE = 2.07e-06 E-VALUE = 1.5e-05 DIAGRAM: 291_[+2]_41_[-2]_126_[-2]_60_[-1]_40_[+1]_149 [+2] 9.1e-07 GGCCACATC + +++ +++226 ATAACGAGTCCGGTGAACTTGGTTCCTTGCTGAACAGTGTCTTCTTGTAAAGCTTCCCATTTGGTGGTCCCGTTC [-2] 1.7e-06 GCCACTGGCGGC GCCGCCAGTGGCGATGTGGCC +++ +++++ ++ + +++++++ ++ +++ + +301 AACTCCGTCAGGTCTTCCACGTGGAACTGCCAAGCCTCCTTCAGATCGCTCTTGTCGACCGTCTCCAAGAGATCC [-2] 2.5e-08 GCCGCCAGTGGCGATGTGGCC +++++++++ +++++++ +++451 TGTGTATCGGGGACTTCTCTTAGAGTAGAAGCGTCTATAAACCCAGGTGGGACGACAGTAGTGATGGCGCCGCCG [-1] 3.4e-06 GGGGCGGCATGTGAA +++ +++++++++ +526 TATAATTCGACTTCCTTGTTGTTCATGCTTCCTTGATGACCAGGGTAGGTGTCAATGAGAGTGCATGTGGAAAGT [+1] 2.0e-06 TTCACATGCCGCCCC ++++ ++++++ +++601 TGCACCGGTTGTGAAATATGAGAAGCCTTTTCAATCTTCATATGCAAACCCACACATGCATCGTTGGTTTCTGTCACC1 sequence of the region upstream from YNR016C LENGTH = 800 COMBINED P-VALUE = 8.22e-06 E-VALUE = 5.8e-05 DIAGRAM: 52_[-2]_9_[+1]_703 [-2] 2.5e-07 GCCGCCAGTGGCGATGTGGCC +++ ++++ +++ ++ ++++1 TATCCAAAGGGGAATGCTTCATCTTGTTGAACAACGCCCAACAATTTCCACTGCCCACCGAATCGTTGCGCCCGT [+1] 8.8e-07 TTCACATGCCGCCCC ++++++++++++ +76 TAAAATCTTCACATGGCCCGGCCGCGCGCGCGTTGTGCCAACAAGTCGCAGTCGAAATTCAACCGCTCATTGCCACHO1 sequence of the region upstream from YER026C LENGTH = 800 COMBINED P-VALUE = 3.22e-03 E-VALUE = 0.023 DIAGRAM: 162_[+1]_433_[+1]_14_[+1]_146 [+1] 6.4e-06 TTCACATGCCGCCCC +++ +++ +++ +++151 CGTCTGGCGCCCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAATACAT [+1] [+1] 4.5e-07 1.5e-06 TTCACATGCCGCCCC TTCACATGCCGCCCC ++++++ ++++++++ +++++++++++++ +601 ACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTTTCACATGGACCCATCTAAAGATGAAGATCCGTATTCHO2 sequence of the region upstream from YGR157W LENGTH = 800 COMBINED P-VALUE = 1.35e-02 E-VALUE = 0.094 DIAGRAM: 353_[+1]_109_[-1]_308 [+1] 1.2e-06 TTCACATGCCGCCCC +++ +++++++++++301 ATATATATTTTTGCCTTGGTTTAAATTGGTCAAGACAGTCAATTGCCACACTTTTCTCATGCCGCATTCATTATT [-1] 1.2e-05 GGGGCGGCATGTGAA +++ +++++ ++++451 GTGGATCTCCGACACATGTGAATTTATAAGTAGGCATATGAAAATACAGATTCTTTCCACTGTGTTCCCTTTTAT********************************************************************************CPU: rocks-155.sdsc.eduTime 0.011998 secs.mast meme.INO_up800.tcm⌨️ 快捷键说明
复制代码
Ctrl + C
搜索代码
Ctrl + F
全屏模式
F11
切换主题
Ctrl + Shift + D
显示快捷键
?
增大字号
Ctrl + =
减小字号
Ctrl + -