primer3.itable

emboss的linux版本的源代码

<tr>
<td>-oligoinput</td>
<td>The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE.</td>
<td>Any string is accepted</td>
<td><i>An empty string is accepted</i></td>
</tr>

<tr>
<td>-oligoosize</td>
<td>Optimum length (in bases) of an internal oligo. Primer3 will attempt to pick primers close to this length.</td>
<td>Integer 0 or more</td>
<td>20</td>
</tr>

<tr>
<td>-oligominsize</td>
<td>Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE.</td>
<td>Integer 0 or more</td>
<td>18</td>
</tr>

<tr>
<td>-oligomaxsize</td>
<td>Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Primer3's melting-temperature is valid.</td>
<td>Integer up to 35</td>
<td>27</td>
</tr>

<tr>
<td>-oligootm</td>
<td>Optimum melting temperature (Celsius) for an internal oligo. Primer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.</td>
<td>Any integer value</td>
<td>60.0</td>
</tr>

<tr>
<td>-oligomintm</td>
<td>Minimum acceptable melting temperature(Celsius) for an internal oligo.</td>
<td>Any integer value</td>
<td>57.0</td>
</tr>

<tr>
<td>-oligomaxtm</td>
<td>Maximum acceptable melting temperature (Celsius) for an internal oligo.</td>
<td>Any integer value</td>
<td>63.0</td>
</tr>

<tr>
<td>-oligoogcpercent</td>
<td>Internal oligo optimum GC percent.</td>
<td>Any integer value</td>
<td>50.0</td>
</tr>

<tr>
<td>-oligomingc</td>
<td>Minimum allowable percentage of Gs and Cs in an internal oligo.</td>
<td>Any integer value</td>
<td>20.0</td>
</tr>

<tr>
<td>-oligomaxgc</td>
<td>Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.</td>
<td>Any integer value</td>
<td>80.0</td>
</tr>

<tr>
<td>-oligosaltconc</td>
<td>The millimolar concentration of salt (usually KCl) in the hybridization. Primer3 uses this argument to calculate internal oligo melting temperatures.</td>
<td>Any integer value</td>
<td>50.0</td>
</tr>

<tr>
<td>-oligodnaconc</td>
<td>The nanomolar concentration of annealing internal oligo in the hybridization.</td>
<td>Any integer value</td>
<td>50.0</td>
</tr>

<tr>
<td>-oligoselfany</td>
<td>The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.</td>
<td>Number up to 9999.990</td>
<td>12.00</td>
</tr>

<tr>
<td>-oligoselfend</td>
<td>The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity.
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'.
INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY.</td>
<td>Number up to 9999.990</td>
<td>12.00</td>
</tr>

<tr>
<td>-oligomaxpolyx</td>
<td>The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA.</td>
<td>Integer 0 or more</td>
<td>5</td>
</tr>

<tr bgcolor="#FFFFD0">
<th align="left" colspan=2>Advanced qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>-explainflag</td>
<td>If this flag is non-0, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Primer3 examined, and statistics on the number discarded for various reasons.</td>
<td>Yes/No</td>
<td>No</td>
</tr>

<tr>
<td>-fileflag</td>
<td>If the associated value is non-0, then Primer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, Primer3 produces a file (sequence-id).int, which lists all acceptable internal oligos.</td>
<td>Yes/No</td>
<td>No</td>
</tr>

<tr>
<td>-firstbaseindex</td>
<td>This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.)</td>
<td>Any integer value</td>
<td>1</td>
</tr>

<tr>
<td>-pickanyway</td>
<td>If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints.</td>
<td>Yes/No</td>
<td>No</td>
</tr>

<tr>
<td>-mispriminglibrary</td>
<td>The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Primer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.)
Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Primer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length.
An empty value for this parameter indicates that no repeat library should be used.</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>

<tr>
<td>-maxmispriming</td>
<td>The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.</td>
<td>Number up to 9999.990</td>
<td>12.00</td>
</tr>

<tr>
<td>-pairmaxmispriming</td>
<td>The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY.</td>
<td>Number up to 9999.990</td>
<td>24.00</td>
</tr>

<tr>
<td>-numnsaccepted</td>
<td>Maximum number of unknown bases (N) allowable in any primer.</td>
<td>Integer 0 or more</td>
<td>0</td>
</tr>

<tr>
<td>-selfany</td>
<td>The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
...|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
...|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.</td>
<td>Number from 0.000 to 9999.990</td>
<td>8.00</td>
</tr>

<tr>
<td>-selfend</td>
<td>The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example
5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||
..........3' AAGTCCTACATTTAGCCTAGT 5'
or
5' AGGCTATGGGCCTCGCGA 3'
...............||||||
............3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.</td>
<td>Number 0.000 or more</td>
<td>3.00</td>
</tr>

<tr>
<td>-maxendstability</td>
<td>The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Primer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ).</td>
<td>Number up to 1000.000</td>
<td>9.0</td>
</tr>

<tr>
<td>-oligomishyblibrary</td>
<td>Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them.
The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Primer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.)
Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Primer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length.
An empty value for this parameter indicates that no library should be used.</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>

<tr>
<td>-oligomaxmishyb</td>
<td>Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.</td>
<td>Number up to 9999.990</td>
<td>12.0</td>
</tr>

</table>