primer3.ihelp

emboss的linux版本的源代码

                                  D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]);
                                  we briefly discuss the organization of this
                                  file below. If this parameter is specified
                                  then Primer3 locally aligns each candidate
                                  primer against each library sequence and
                                  rejects those primers for which the local
                                  alignment score times a specified weight
                                  (see below) exceeds MAX-MISPRIMING. (The
                                  maximum value of the weight is arbitrarily
                                  set to 100.0.)
                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that Primer3 parses
                                  everything after any optional asterisk
                                  ('*') as a floating point number to use as
                                  the weight mentioned above. If the id line
                                  contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no repeat library should be used.
   -maxmispriming      float      The maximum allowed weighted similarity with
                                  any sequence in MISPRIMING-LIBRARY.
   -pairmaxmispriming  float      The maximum allowed sum of weighted
                                  similarities of a primer pair (one
                                  similarity for each primer) with any single
                                  sequence in MISPRIMING-LIBRARY.
   -numnsaccepted      integer    Maximum number of unknown bases (N)
                                  allowable in any primer.
   -selfany            float      The maximum allowable local alignment score
                                  when testing a single primer for (local)
                                  self-complementarity and the maximum
                                  allowable local alignment score when testing
                                  for complementarity between forward and
                                  reverse primers. Local self-complementarity
                                  is taken to predict the tendency of primers
                                  to anneal to each other without necessarily
                                  causing self-priming in the PCR. The scoring
                                  system gives 1.00 for complementary bases,
                                  -0.25 for a match of any base (or N) with an
                                  N, -1.00 for a mismatch, and -2.00 for a
                                  gap. Only single-base-pair gaps are allowed.
                                  For example, the alignment
                                  5' ATCGNA 3'
                                  ...|| | |
                                  3' TA-CGT 5'
                                  is allowed (and yields a score of 1.75), but
                                  the alignment
                                  5' ATCCGNA 3'
                                  ...|| | |
                                  3' TA--CGT 5'
                                  is not considered. Scores are non-negative,
                                  and a score of 0.00 indicates that there is
                                  no reasonable local alignment between two
                                  oligos.
   -selfend            float      The maximum allowable 3'-anchored global
                                  alignment score when testing a single primer
                                  for self-complementarity, and the maximum
                                  allowable 3'-anchored global alignment score
                                  when testing for complementarity between
                                  forward and reverse primers. The 3'-anchored
                                  global alignment score is taken to predict
                                  the likelihood of PCR-priming primer-dimers,
                                  for example
                                  5' ATGCCCTAGCTTCCGGATG 3'
                                  .............||| |||||
                                  ..........3' AAGTCCTACATTTAGCCTAGT 5'
                                  or
                                  5' AGGCTATGGGCCTCGCGA 3'
                                  ...............||||||
                                  ............3' AGCGCTCCGGGTATCGGA 5'
                                  The scoring system is as for the Maximum
                                  Complementarity argument. In the examples
                                  above the scores are 7.00 and 6.00
                                  respectively. Scores are non-negative, and a
                                  score of 0.00 indicates that there is no
                                  reasonable 3'-anchored global alignment
                                  between two oligos. In order to estimate
                                  3'-anchored global alignments for candidate
                                  primers and primer pairs, Primer assumes
                                  that the sequence from which to choose
                                  primers is presented 5' to 3'. It is
                                  nonsensical to provide a larger value for
                                  this parameter than for the Maximum (local)
                                  Complementarity parameter because the score
                                  of a local alignment will always be at least
                                  as great as the score of a global
                                  alignment.
   -maxendstability    float      The maximum stability for the five 3' bases
                                  of a forward or reverse primer. Bigger
                                  numbers mean more stable 3' ends. The value
                                  is the maximum delta G for duplex disruption
                                  for the five 3' bases as calculated using
                                  the nearest neighbor parameters published in
                                  Breslauer, Frank, Bloeker and Marky, Proc.
                                  Natl. Acad. Sci. USA, vol 83, pp 3746-3750.
                                  Primer3 uses a completely permissive default
                                  value for backward compatibility (which we
                                  may change in the next release). Rychlik
                                  recommends a maximum value of 9 (Wojciech
                                  Rychlik, 'Selection of Primers for
                                  Polymerase Chain Reaction' in BA White, Ed.,
                                  'Methods in Molecular Biology, Vol. 15: PCR
                                  Protocols: Current Methods and
                                  Applications', 1993, pp 31-40, Humana Press,
                                  Totowa NJ).
   -oligomishyblibrary infile     Similar to MISPRIMING-LIBRARY, except that
                                  the event we seek to avoid is hybridization
                                  of the internal oligo to sequences in this
                                  library rather than priming from them.
                                  The file must be in (a slightly restricted)
                                  FASTA format (W. B. Pearson and D.J. Lipman,
                                  PNAS 85:8 pp 2444-2448 [1988]); we briefly
                                  discuss the organization of this file below.
                                  If this parameter is specified then Primer3
                                  locally aligns each candidate oligo against
                                  each library sequence and rejects those
                                  primers for which the local alignment score
                                  times a specified weight (see below) exceeds
                                  INTERNAL-OLIGO-MAX-MISHYB. (The maximum
                                  value of the weight is arbitrarily set to
                                  12.0.)
                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that Primer3 parses
                                  everything after any optional asterisk
                                  ('*') as a floating point number to use as
                                  the weight mentioned above. If the id line
                                  contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no library should be used.
   -oligomaxmishyb     float      Similar to MAX-MISPRIMING except that this
                                  parameter applies to the similarity of
                                  candidate internal oligos to the library
                                  specified in INTERNAL-OLIGO-MISHYB-LIBRARY.

   General qualifiers:
  -help                bool       report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose