eprimer3.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 987 行 · 第 1/4 页

TXT
987
字号
                                  Each sequence entry in the FASTA-format file                                  must begin with an 'id line' that starts                                  with '>'. The contents of the id line is                                  'slightly restricted' in that EPrimer3                                  parses everything after any optional                                  asterisk ('*') as a floating point number to                                  use as the weight mentioned above. If the                                  id line contains no asterisk then the weight                                  defaults to 1.0. The alignment scoring                                  system used is the same as for calculating                                  complementarity among oligos (e.g.                                  SELF-ANY). The remainder of an entry                                  contains the sequence as lines following the                                  id line up until a line starting with '>'                                  or the end of the file. Whitespace and                                  newlines are ignored. Characters 'A', 'T',                                  'G', 'C', 'a', 't', 'g', 'c' are retained                                  and any other character is converted to 'N'                                  (with the consequence that any IUB / IUPAC                                  codes for ambiguous bases are converted to                                  'N'). There are no restrictions on line                                  length.                                  An empty value for this parameter indicates                                  that no repeat library should be used.   -explainflag        boolean    [N] If this flag is true, produce                                  LEFT-EXPLAIN, RIGHT-EXPLAIN, and                                  INTERNAL-OLIGO-EXPLAIN output tags, which                                  are intended to provide information on the                                  number of oligos and primer pairs that                                  EPrimer3 examined, and statistics on the                                  number discarded for various reasons.   -fileflag           boolean    [N] If the associated value is true, then                                  EPrimer3 creates two output files for each                                  input SEQUENCE. File (sequence-id).for lists                                  all acceptable forward primers for                                  (sequence-id), and (sequence-id).rev lists                                  all acceptable reverse primers for                                  (sequence-id), where (sequence-id) is the                                  value of the SEQUENCE-ID tag (which must be                                  supplied). In addition, if the input tag                                  TASK is 1 or 4, EPrimer3 produces a file                                  (sequence-id).int, which lists all                                  acceptable internal oligos.   -firstbaseindex     integer    [1] This parameter is the index of the first                                  base in the input sequence. For input and                                  output using 1-based indexing (such as that                                  used in GenBank and to which many users are                                  accustomed) set this parameter to 1. For                                  input and output using 0-based indexing set                                  this parameter to 0. (This parameter also                                  affects the indexes in the contents of the                                  files produced when the primer file flag is                                  set.) (Any integer value)   -pickanyway         boolean    [N] If true pick a primer pair even if                                  LEFT-INPUT, RIGHT-INPUT, or                                  INTERNAL-OLIGO-INPUT violates specific                                  constraints.   -maxmispriming      float      [12.00] The maximum allowed weighted                                  similarity with any sequence in                                  MISPRIMING-LIBRARY. (Number up to 9999.990)   -pairmaxmispriming  float      [24.00] The maximum allowed sum of weighted                                  similarities of a primer pair (one                                  similarity for each primer) with any single                                  sequence in MISPRIMING-LIBRARY. (Number up                                  to 9999.990)   -numnsaccepted      integer    [0] Maximum number of unknown bases (N)                                  allowable in any primer. (Integer 0 or more)   -selfany            float      [8.00] The maximum allowable local alignment                                  score when testing a single primer for                                  (local) self-complementarity and the maximum                                  allowable local alignment score when                                  testing for complementarity between forward                                  and reverse primers. Local                                  self-complementarity is taken to predict the                                  tendency of primers to anneal to each other                                  without necessarily causing self-priming in                                  the PCR. The scoring system gives 1.00 for                                  complementary bases, -0.25 for a match of                                  any base (or N) with an N, -1.00 for a                                  mismatch, and -2.00 for a gap. Only                                  single-base-pair gaps are allowed. For                                  example, the alignment                                  5' ATCGNA 3'                                  ...|| | |                                  3' TA-CGT 5'                                  is allowed (and yields a score of 1.75), but                                  the alignment                                  5' ATCCGNA 3'                                  ...|| | |                                  3' TA--CGT 5'                                  is not considered. Scores are non-negative,                                  and a score of 0.00 indicates that there is                                  no reasonable local alignment between two                                  oligos. (Number from 0.000 to 9999.990)   -selfend            float      [3.00] The maximum allowable 3'-anchored                                  global alignment score when testing a single                                  primer for self-complementarity, and the                                  maximum allowable 3'-anchored global                                  alignment score when testing for                                  complementarity between forward and reverse                                  primers. The 3'-anchored global alignment                                  score is taken to predict the likelihood of                                  PCR-priming primer-dimers, for example                                  5' ATGCCCTAGCTTCCGGATG 3'                                  .............||| |||||                                  ..........3' AAGTCCTACATTTAGCCTAGT 5'                                  or                                  5' AGGCTATGGGCCTCGCGA 3'                                  ...............||||||                                  ............3' AGCGCTCCGGGTATCGGA 5'                                  The scoring system is as for the Maximum                                  Complementarity argument. In the examples                                  above the scores are 7.00 and 6.00                                  respectively. Scores are non-negative, and a                                  score of 0.00 indicates that there is no                                  reasonable 3'-anchored global alignment                                  between two oligos. In order to estimate                                  3'-anchored global alignments for candidate                                  primers and primer pairs, Primer assumes                                  that the sequence from which to choose                                  primers is presented 5' to 3'. It is                                  nonsensical to provide a larger value for                                  this parameter than for the Maximum (local)                                  Complementarity parameter because the score                                  of a local alignment will always be at least                                  as great as the score of a global                                  alignment. (Number 0.000 or more)   -maxendstability    float      [9.0] The maximum stability for the five 3'                                  bases of a forward or reverse primer. Bigger                                  numbers mean more stable 3' ends. The value                                  is the maximum delta G for duplex                                  disruption for the five 3' bases as                                  calculated using the nearest neighbor                                  parameters published in Breslauer, Frank,                                  Bloeker and Marky, Proc. Natl. Acad. Sci.                                  USA, vol 83, pp 3746-3750. EPrimer3 uses a                                  completely permissive default value for                                  backward compatibility (which we may change                                  in the next release). Rychlik recommends a                                  maximum value of 9 (Wojciech Rychlik,                                  'Selection of Primers for Polymerase Chain                                  Reaction' in BA White, Ed., 'Methods in                                  Molecular Biology, Vol. 15: PCR Protocols:                                  Current Methods and Applications', 1993, pp                                  31-40, Humana Press, Totowa NJ). (Number up                                  to 1000.000)   Associated qualifiers:   "-sequence" associated qualifiers   -sbegin1            integer    Start of each sequence to be used   -send1              integer    End of each sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-outfile" associated qualifiers   -odirectory2        string     Output directory   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format   eprimer3 reads a normal nucleic acid sequence USA.  Input files for usage example   'tembl:hsfau1' is a sequence entry in the example nucleic acid   database 'tembl'  Database entry: tembl:hsfau1ID   HSFAU1     standard; DNA; HUM; 2016 BP.XXAC   X65921; S45242;XXSV   X65921.1XXDT   13-MAY-1992 (Rel. 31, Created)DT   21-JUL-1993 (Rel. 36, Last updated, Version 5)XXDE   H.sapiens fau 1 geneXXKW   fau 1 gene.XXOS   Homo sapiens (human)OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;OC   Eutheria; Primates; Catarrhini; Hominidae; Homo.XXRN   [1]RP   1-2016RA   Kas K.;RT   ;RL   Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.RL   K. Kas, University of Antwerp, Dept of Biochemistry T3.22,RL   Universiteitsplein 1, 2610 Wilrijk, BELGIUMXXRN   [2]RP   1-2016RX   MEDLINE; 92412144.RA   Kas K., Michiels L., Merregaert J.;RT   "Genomic structure and expression of the human fau gene: encoding theRT   ribosomal protein S30 fused to a ubiquitin-like protein.";RL   Biochem. Biophys. Res. Commun. 187:927-933(1992).XXDR   SWISS-PROT; P35544; UBIM_HUMAN.DR   SWISS-PROT; Q05472; RS30_HUMAN.XXFH   Key             Location/QualifiersFHFT   source          1..2016FT                   /db_xref="taxon:9606"FT                   /organism="Homo sapiens"FT                   /clone_lib="CML cosmid"FT                   /clone="15.1"FT   mRNA            join(408..504,774..856,951..1095,1557..1612,1787..>1912)FT                   /gene="fau 1"FT   exon            408..504FT                   /number=1FT   intron          505..773FT                   /number=1FT   exon            774..856

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?