eprimer3.txt

emboss的linux版本的源代码

                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that EPrimer3
                                  parses everything after any optional
                                  asterisk ('*') as a floating point number to
                                  use as the weight mentioned above. If the
                                  id line contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no repeat library should be used.
   -explainflag        boolean    [N] If this flag is true, produce
                                  LEFT-EXPLAIN, RIGHT-EXPLAIN, and
                                  INTERNAL-OLIGO-EXPLAIN output tags, which
                                  are intended to provide information on the
                                  number of oligos and primer pairs that
                                  EPrimer3 examined, and statistics on the
                                  number discarded for various reasons.
   -fileflag           boolean    [N] If the associated value is true, then
                                  EPrimer3 creates two output files for each
                                  input SEQUENCE. File (sequence-id).for lists
                                  all acceptable forward primers for
                                  (sequence-id), and (sequence-id).rev lists
                                  all acceptable reverse primers for
                                  (sequence-id), where (sequence-id) is the
                                  value of the SEQUENCE-ID tag (which must be
                                  supplied). In addition, if the input tag
                                  TASK is 1 or 4, EPrimer3 produces a file
                                  (sequence-id).int, which lists all
                                  acceptable internal oligos.
   -firstbaseindex     integer    [1] This parameter is the index of the first
                                  base in the input sequence. For input and
                                  output using 1-based indexing (such as that
                                  used in GenBank and to which many users are
                                  accustomed) set this parameter to 1. For
                                  input and output using 0-based indexing set
                                  this parameter to 0. (This parameter also
                                  affects the indexes in the contents of the
                                  files produced when the primer file flag is
                                  set.) (Any integer value)
   -pickanyway         boolean    [N] If true pick a primer pair even if
                                  LEFT-INPUT, RIGHT-INPUT, or
                                  INTERNAL-OLIGO-INPUT violates specific
                                  constraints.
   -maxmispriming      float      [12.00] The maximum allowed weighted
                                  similarity with any sequence in
                                  MISPRIMING-LIBRARY. (Number up to 9999.990)
   -pairmaxmispriming  float      [24.00] The maximum allowed sum of weighted
                                  similarities of a primer pair (one
                                  similarity for each primer) with any single
                                  sequence in MISPRIMING-LIBRARY. (Number up
                                  to 9999.990)
   -numnsaccepted      integer    [0] Maximum number of unknown bases (N)
                                  allowable in any primer. (Integer 0 or more)
   -selfany            float      [8.00] The maximum allowable local alignment
                                  score when testing a single primer for
                                  (local) self-complementarity and the maximum
                                  allowable local alignment score when
                                  testing for complementarity between forward
                                  and reverse primers. Local
                                  self-complementarity is taken to predict the
                                  tendency of primers to anneal to each other
                                  without necessarily causing self-priming in
                                  the PCR. The scoring system gives 1.00 for
                                  complementary bases, -0.25 for a match of
                                  any base (or N) with an N, -1.00 for a
                                  mismatch, and -2.00 for a gap. Only
                                  single-base-pair gaps are allowed. For
                                  example, the alignment
                                  5' ATCGNA 3'
                                  ...|| | |
                                  3' TA-CGT 5'
                                  is allowed (and yields a score of 1.75), but
                                  the alignment
                                  5' ATCCGNA 3'
                                  ...|| | |
                                  3' TA--CGT 5'
                                  is not considered. Scores are non-negative,
                                  and a score of 0.00 indicates that there is
                                  no reasonable local alignment between two
                                  oligos. (Number from 0.000 to 9999.990)
   -selfend            float      [3.00] The maximum allowable 3'-anchored
                                  global alignment score when testing a single
                                  primer for self-complementarity, and the
                                  maximum allowable 3'-anchored global
                                  alignment score when testing for
                                  complementarity between forward and reverse
                                  primers. The 3'-anchored global alignment
                                  score is taken to predict the likelihood of
                                  PCR-priming primer-dimers, for example
                                  5' ATGCCCTAGCTTCCGGATG 3'
                                  .............||| |||||
                                  ..........3' AAGTCCTACATTTAGCCTAGT 5'
                                  or
                                  5' AGGCTATGGGCCTCGCGA 3'
                                  ...............||||||
                                  ............3' AGCGCTCCGGGTATCGGA 5'
                                  The scoring system is as for the Maximum
                                  Complementarity argument. In the examples
                                  above the scores are 7.00 and 6.00
                                  respectively. Scores are non-negative, and a
                                  score of 0.00 indicates that there is no
                                  reasonable 3'-anchored global alignment
                                  between two oligos. In order to estimate
                                  3'-anchored global alignments for candidate
                                  primers and primer pairs, Primer assumes
                                  that the sequence from which to choose
                                  primers is presented 5' to 3'. It is
                                  nonsensical to provide a larger value for
                                  this parameter than for the Maximum (local)
                                  Complementarity parameter because the score
                                  of a local alignment will always be at least
                                  as great as the score of a global
                                  alignment. (Number 0.000 or more)
   -maxendstability    float      [9.0] The maximum stability for the five 3'
                                  bases of a forward or reverse primer. Bigger
                                  numbers mean more stable 3' ends. The value
                                  is the maximum delta G for duplex
                                  disruption for the five 3' bases as
                                  calculated using the nearest neighbor
                                  parameters published in Breslauer, Frank,
                                  Bloeker and Marky, Proc. Natl. Acad. Sci.
                                  USA, vol 83, pp 3746-3750. EPrimer3 uses a
                                  completely permissive default value for
                                  backward compatibility (which we may change
                                  in the next release). Rychlik recommends a
                                  maximum value of 9 (Wojciech Rychlik,
                                  'Selection of Primers for Polymerase Chain
                                  Reaction' in BA White, Ed., 'Methods in
                                  Molecular Biology, Vol. 15: PCR Protocols:
                                  Current Methods and Applications', 1993, pp
                                  31-40, Humana Press, Totowa NJ). (Number up
                                  to 1000.000)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   eprimer3 reads a normal nucleic acid sequence USA.

  Input files for usage example

   'tembl:hsfau1' is a sequence entry in the example nucleic acid
   database 'tembl'

  Database entry: tembl:hsfau1

ID   HSFAU1     standard; DNA; HUM; 2016 BP.
XX
AC   X65921; S45242;
XX
SV   X65921.1
XX
DT   13-MAY-1992 (Rel. 31, Created)
DT   21-JUL-1993 (Rel. 36, Last updated, Version 5)
XX
DE   H.sapiens fau 1 gene
XX
KW   fau 1 gene.
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia
;
OC   Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN   [1]
RP   1-2016
RA   Kas K.;
RT   ;
RL   Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL   K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL   Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN   [2]
RP   1-2016
RX   MEDLINE; 92412144.
RA   Kas K., Michiels L., Merregaert J.;
RT   "Genomic structure and expression of the human fau gene: encoding the
RT   ribosomal protein S30 fused to a ubiquitin-like protein.";
RL   Biochem. Biophys. Res. Commun. 187:927-933(1992).
XX
DR   SWISS-PROT; P35544; UBIM_HUMAN.
DR   SWISS-PROT; Q05472; RS30_HUMAN.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..2016
FT                   /db_xref="taxon:9606"
FT                   /organism="Homo sapiens"
FT                   /clone_lib="CML cosmid"
FT                   /clone="15.1"
FT   mRNA            join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT                   /gene="fau 1"
FT   exon            408..504
FT                   /number=1
FT   intron          505..773
FT                   /number=1
FT   exon            774..856