📄 einverted.txt
字号:
0 tgcaacatgt tgcttatttt caaattacag tttaatgtct aggtgccagc ccttgatata 16800 gctatttttg taagaacatc ctcctggact ttgggttagt taaatctaaa cttatttaag 16860 gattaagtag gataacgtgc attgatttgc taaaagaatc aagtaataat tacttagctg 16920 attcctgagg gtggtatgac ttctagctga actcatcttg atcggtagga ttttttaaat 16980 ccatttttgt aaaactattt ccaagaaatt ttaagccctt tcacttcaga aagaaaaaag 17040 ttgttggggc tgagcactta attttcttga gcaggaagga gtttcttcca aacttcacca 17100 tctggagact ggtgtttctt tacagattcc tccttcattt ctgttgagta gccgggatcc 17160 tatcaaagac caaaaaaatg agtcctgtta acaaccacct ggaacaaaaa cagattttat 17220 gcatttatgc tgctccaaga aatgctttta cgtctaagcc agaggcaatt aattaatttt 17280 tttttttttg acatggagtc actgtccgtt gcccaggctg cagtgcagtg gcgcaatctt 17340 ggctcactgc aacctccacc tcccaggttc aagtgattct cctgcctcag cctcccatgt 17400 agctgggatc acaggcacct gccaccatgc ccggctaatt ttttgtattt tttgtagaga 17460 cagggtttca ccatgttggc caggctggtc tcaaacacct gacctcaaat gatccacctg 17520 cctcagcctc ccaaagtgtt gggattacag gcgtaagcca ccatgcccag ccctgaatta 17580 atatttttaa aataagtttg gagactgttg gaaataatag ggcagaggaa catattttac 17640 tggctacttg ccagagttag ttaactcatc aaactctttg ataatagttt gacctctgtt 17700 ggtgaaaatg agccatgatc tcttgaacat gatcagaata aatgccccag ccacacaatt 17760 gtagtccaaa ctttttaggt cactaacttg ctagatggtg ccaggttttt ttgcacaagg 17820 agtgcaaatg ttaagatctc cactagtgag gaaaggctag tattacagaa gccttgtcag 17880 aggcaattga acctccaagc cctggccctc aggcctgagg attttgatac agacaaactg 17940 aagaaccgtt tgttagtgga tattgcaaac aaacaggagt caaagcttgg tgctccacag 18000 tctagttcac gagacaggcg tggcagtggc tggcagcatc tcttctcaca ggggccctca 18060 ggcacagctt accttgggag gcatgtagga agcccgctgg atcatcacgg gatacttgaa 18120 atgctcatgc aggtggtcaa catactcaca caccctagga ggagggaatc agatcggggc 18180 aatgatgcct gaagtcagat tattcacgtg gtgctaactt aaagcagaag gagcgagtac 18240 cactcaattg acagtgttgg ccaaggctta gctgtgttac catgcgtttc taggcaagtc 18300 cctaaacctc tgtgcctcag gtccttttct tctaaaatat agcaatgtga ggtggggact 18360 ttgatgacat gaacacacga agtccctctg agaggttttg tggtgccctt taaaagggat 18420 caattcagac tctgtaaata tccagaatta tttgggttcc tctggtcaaa agtcagatga 18480 atagattaaa atcaccacat tttgtgatct atttttcaag aagcgtttgt attttttcat 18540 atggctgcag cagctgccag gggcttgggg tttttttggc aggtagggtt gggagg 18596//Output file format Output files for usage example File: hsts1.fasta>HSTS1_13_142gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa>HSTS1_199_328ttttttttttttttttttgggacagtcttgctctgtcgcccaggctggagtacaatggtcggatcttggctcactgcaacctctgcctcccaggttcaagcaattcttctgcctcagcctcccaagtagc>HSTS1_12128_12301agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacggcgtgatcttggctcactgtaacctctgcctcctgggttcgagtgattctcctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcctggct>HSTS1_12573_12749agccaggtgtggtggctcacacctgtaattccaacaactccagaggccaaggcgagaggatcatttgaacccacggaatttgaggctgtagtgagtcatgatcacgccattgcactccatcctgggcaacagagtgagaccctgaatatttaaaaacaacaacaacaacaaaactct>HSTS1_12246_12296ctcctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcc>HSTS1_13886_13938ggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggag>HSTS1_13884_13949tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga>HSTS1_14628_14692tcaagcaattcttctgcctcagcctcccaggtagctgggattacaggcacatgccaccacaccca File: hsts1.invHSTS1: Score 236: 108/130 ( 83%) matches, 0 gaps 13 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa 142 ||||| | ||||||||||||| |||||| |||||||| |||||| |||||||||||||||| ||||| ||| || ||||||||||||| || ||||| ||||| | | |||||||||||||||| 328 cgatgaaccctccgactccgtcttcttaacgaacttggaccctccgtctccaacgtcactcggttctaggctggtaacatgaggtcggacccgctgtctcgttctgacagggtttttttttttttttttt 199HSTS1: Score 164: 128/174 ( 73%) matches, 3 gaps 12128 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacggcgtgatcttggctcactgtaacctctgcctcc-tgggttcgagtgattctcctgcctcagcctc-caagtagctgggattaca-gcatgtgccaccatgcctggct 12301 |||| || || || || || ||||| | ||| || | |||||||||||||| |||| ||||| ||||||||| || |||||| | |||| ||| ||||||| | |||| ||| |||| ||||| ||| | ||| |||||| | || ||||||| ||||||| 12749 tctcaaaacaacaacaacaacaaaaatttataagtcccagagtgagacaacgggtcctacctcacgttaccgcactagtactgagtgatgtcggagtttaaggcacccaagtttactaggagagcggaaccggagacctcaacaaccttaatgtccacactcggtggtgtggaccga 12573HSTS1: Score 80: 44/51 ( 86%) matches, 2 gaps 12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296 |||||| ||||| | ||||| |||||||||||| ||||| |||||||| || 13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886HSTS1: Score 99: 53/65 ( 81%) matches, 1 gaps 13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949 ||||| ||||||| |||||||||||||||| ||| || ||||| ||| || |||||||||| 14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628Data files None.Notes Sometimes you can find repeats using the program palindrome that you can't find with einverted using the default parameters. This is not due to a problem with either program. It is simply because some of the shortest repeats that you find with palindrome's default parameter values are below einverted's default cutoff score - you should decrease the 'Minimum score threshold' to see them. For example, when palindrome is run with 'em:hsfau1', it finds the repeat:64 aaaactaaggc 74 |||||||||||98 ttttgattccg 88 einverted will not report this as its score is 33 (11 bases scoring 3 each, no mismatches or gaps) with is below the default score cutoff of 50. If einverted is run as: % einverted em:hsfau1 -threshold 33 then it will find it:Score 33: 11/11 (100%) matches, 0 gaps 64 aaaactaaggc 74 ||||||||||| 98 ttttgattccg 88 Anything can be considered to be a repeat if you set the score threshold low enough! einverted does not report overlapping matches. The original "inverted" program was written to annotate the nematode genome. Excluding overlapping repeats saved problems with simple repeat sequences in this genome.References Some useful references on inverted repeats: 1. Pearson CE, Zorbas H, Price GB, Zannis-Hadjopoulos M Inverted repeats, stem-loops, and cruciforms: significance for initiation of DNA replication. J Cell Biochem 1996 Oct;63(1):1-22 2. Waldman AS, Tran H, Goldsmith EC, Resnick MA. q Long inverted repeats are an at-risk motif for recombination in mammalian cells. Genetics. 1999 Dec;153(4):1873-83. PMID: 10581292; UI: 20050682 3. Jacobsen SE Gene silencing: Maintaining methylation patterns. Curr Biol 1999 Aug 26;9(16):R617-9 4. Lewis S, Akgun E, Jasin M. Palindromic DNA and genome stability. Further studies. Ann N Y Acad Sci. 1999 May 18;870:45-57. PMID: 10415472; UI: 99343961 5. Dai X, Greizerstein MB, Nadas-Chinni K, Rothman-Denes LB Supercoil-induced extrusion of a regulatory DNA hairpin. Proc Natl Acad Sci U S A 1997 Mar 18;94(6):2174-9Warnings None.Diagnostic Error Messages None.Exit status It always exits with a status of 0.Known bugs None.See also Program name Description equicktandem Finds tandem repeats etandem Looks for tandem repeats in a nucleotide sequence palindrome Looks for inverted repeats in a nucleotide sequence palindrome also looks for inverted repeats but is much faster and less sensitive, as it looks for near-perfect repeats.Author(s) This program was originally written by Richard Durbin (rd
⌨️ 快捷键说明
复制代码
Ctrl + C
搜索代码
Ctrl + F
全屏模式
F11
切换主题
Ctrl + Shift + D
显示快捷键
?
增大字号
Ctrl + =
减小字号
Ctrl + -