📄 dan.txt
字号:
aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900 acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960 tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020 tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080 acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140 gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200 agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260 ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320 cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380 gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440 gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500 gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560 cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620 tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680 gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740 ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800 gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860 aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920 catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980 gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040 gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100 ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160 cctcgag 2167//Output file format If a plot is not being produced, dan reports the sequence of each oligomer window, its melting temperature under the specified conditions and its GC content. The output is a standard EMBOSS report file. The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel, feattable, motif, regions, seqtable, simple, srs, table, tagseq See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats. By default dan writes a 'seqtable' report file. Output files for usage example File: paamir.dan######################################### Program: dan# Rundate: Sat 15 Jul 2006 12:00:00# Commandline: dan# -sequence tembl:paamir# Report_format: seqtable# Report_file: paamir.dan#########################################=======================================## Sequence: PAAMIR from: 1 to: 2167# HitCount: 2148#======================================= Start End Tm GC DeltaG DeltaH DeltaS TmProd Sequence 1 20 64.9 70.0 . . . . ggtaccgctggccgagcatc 2 21 63.7 65.0 . . . . gtaccgctggccgagcatct 3 22 63.7 65.0 . . . . taccgctggccgagcatctg 4 23 66.9 70.0 . . . . accgctggccgagcatctgc 5 24 66.7 70.0 . . . . ccgctggccgagcatctgct 6 25 65.5 70.0 . . . . cgctggccgagcatctgctc 7 26 65.5 70.0 . . . . gctggccgagcatctgctcg 8 27 63.7 65.0 . . . . ctggccgagcatctgctcga 9 28 62.9 60.0 . . . . tggccgagcatctgctcgat 10 29 62.6 65.0 . . . . ggccgagcatctgctcgatc 11 30 61.7 60.0 . . . . gccgagcatctgctcgatca 12 31 60.2 60.0 . . . . ccgagcatctgctcgatcac 13 32 60.2 60.0 . . . . cgagcatctgctcgatcacc 14 33 59.0 55.0 . . . . gagcatctgctcgatcacca 15 34 59.2 55.0 . . . . agcatctgctcgatcaccac 16 35 60.4 60.0 . . . . gcatctgctcgatcaccacc 17 36 58.9 55.0 . . . . catctgctcgatcaccacca 18 37 58.6 55.0 . . . . atctgctcgatcaccaccag 19 38 61.3 60.0 . . . . tctgctcgatcaccaccagc 20 39 62.4 65.0 . . . . ctgctcgatcaccaccagcc 21 40 63.9 65.0 . . . . tgctcgatcaccaccagccg 22 41 64.9 70.0 . . . . gctcgatcaccaccagccgg 23 42 64.3 70.0 . . . . ctcgatcaccaccagccggg 24 43 66.1 70.0 . . . . tcgatcaccaccagccgggc 25 44 67.5 75.0 . . . . cgatcaccaccagccgggcg 26 45 66.1 70.0 . . . . gatcaccaccagccgggcga 27 46 66.3 70.0 . . . . atcaccaccagccgggcgac 28 47 68.6 75.0 . . . . tcaccaccagccgggcgacg 29 48 69.8 80.0 . . . . caccaccagccgggcgacgg 30 49 70.7 80.0 . . . . accaccagccgggcgacggg 31 50 70.5 80.0 . . . . ccaccagccgggcgacggga 32 51 68.6 75.0 . . . . caccagccgggcgacgggaa 33 52 68.6 75.0 . . . . accagccgggcgacgggaac 34 53 68.4 75.0 . . . . ccagccgggcgacgggaact [Part of this file has been deleted for brevity] 2101 2120 69.9 80.0 . . . . ggccggagcgctgaccctgc 2102 2121 68.7 75.0 . . . . gccggagcgctgaccctgct 2103 2122 65.5 70.0 . . . . ccggagcgctgaccctgcta 2104 2123 63.5 65.0 . . . . cggagcgctgaccctgctat 2105 2124 61.3 60.0 . . . . ggagcgctgaccctgctatt 2106 2125 60.1 60.0 . . . . gagcgctgaccctgctattc 2107 2126 61.7 60.0 . . . . agcgctgaccctgctattcg 2108 2127 63.4 65.0 . . . . gcgctgaccctgctattcgc 2109 2128 61.7 60.0 . . . . cgctgaccctgctattcgct 2110 2129 59.5 55.0 . . . . gctgaccctgctattcgctt 2111 2130 57.1 50.0 . . . . ctgaccctgctattcgcttt 2112 2131 56.4 45.0 . . . . tgaccctgctattcgctttt 2113 2132 54.7 45.0 . . . . gaccctgctattcgctttta 2114 2133 55.0 45.0 . . . . accctgctattcgcttttac 2115 2134 55.9 50.0 . . . . ccctgctattcgcttttacc 2116 2135 54.7 45.0 . . . . cctgctattcgcttttacct 2117 2136 52.0 40.0 . . . . ctgctattcgcttttaccta 2118 2137 51.2 35.0 . . . . tgctattcgcttttacctat 2119 2138 50.9 40.0 . . . . gctattcgcttttacctatc 2120 2139 49.0 35.0 . . . . ctattcgcttttacctatct 2121 2140 49.3 35.0 . . . . tattcgcttttacctatctg 2122 2141 51.1 35.0 . . . . attcgcttttacctatctgt 2123 2142 52.2 40.0 . . . . ttcgcttttacctatctgtg 2124 2143 54.0 45.0 . . . . tcgcttttacctatctgtgg 2125 2144 55.2 50.0 . . . . cgcttttacctatctgtggg 2126 2145 53.9 45.0 . . . . gcttttacctatctgtgggt 2127 2146 52.3 45.0 . . . . cttttacctatctgtgggtg 2128 2147 53.5 45.0 . . . . ttttacctatctgtgggtgg 2129 2148 56.0 50.0 . . . . tttacctatctgtgggtggc 2130 2149 57.8 55.0 . . . . ttacctatctgtgggtggcc 2131 2150 60.1 60.0 . . . . tacctatctgtgggtggccg 2132 2151 63.4 65.0 . . . . acctatctgtgggtggccgc 2133 2152 64.3 70.0 . . . . cctatctgtgggtggccgcc 2134 2153 63.4 65.0 . . . . ctatctgtgggtggccgcca 2135 2154 62.7 60.0 . . . . tatctgtgggtggccgccaa 2136 2155 64.5 65.0 . . . . atctgtgggtggccgccaac 2137 2156 66.5 70.0 . . . . tctgtgggtggccgccaacc 2138 2157 66.8 70.0 . . . . ctgtgggtggccgccaacca 2139 2158 66.8 70.0 . . . . tgtgggtggccgccaaccag 2140 2159 66.8 70.0 . . . . gtgggtggccgccaaccagt 2141 2160 65.9 65.0 . . . . tgggtggccgccaaccagtt 2142 2161 65.6 70.0 . . . . gggtggccgccaaccagttc 2143 2162 65.6 70.0 . . . . ggtggccgccaaccagttcc 2144 2163 64.4 65.0 . . . . gtggccgccaaccagttcct 2145 2164 64.1 65.0 . . . . tggccgccaaccagttcctc 2146 2165 65.4 70.0 . . . . ggccgccaaccagttcctcg 2147 2166 64.2 65.0 . . . . gccgccaaccagttcctcga 2148 2167 62.4 65.0 . . . . ccgccaaccagttcctcgag#---------------------------------------#--------------------------------------- Output files for usage example 2 Graphics File: dan.ps [dan results] File: paamir.dan The header information contains details of the program, date and sequence Subsequent lines contain columns of data for each window into the sequence as it is moved along, giving: * The start postion of the window * The end position of the window * The melting temperature of the window * The percentage C+G of the window * The sequence of the window If the qualifier '-product' is used to make the program prompt for percent formamide percent of mismatches allowed and product length, then the output includes the melting temperature of the specified product. If the qualifier '-thermo' is gived then the DeltaG, DeltaH and DeltaS of the sequence in the window is also output.Data files The EMBOSS data files "Edna.melt" and "Erna.melt" are used to read in the entropy/enthalpy/energy data for DNA and RNA respectively. EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA. To see the available EMBOSS data files, run:% embossdata -showall To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:% embossdata -fetch -file Exxx.dat Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata". The directories are searched in the following order: * . (your current directory) * .embossdata (under your current directory) * ~/ (your home directory) * ~/.embossdataNotes None.References 1. Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986). "Predicting DNA Duplex Stability from the Base Sequence." Proceedings of the National Academy of Sciences USA 83, 3746-3750. 2. Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168, 761-777, Academic Press, San Diego, California, USA.Warnings RNA sequences must be submited to this application with the '-rna' qualifier on the command line, otherwise the sequence will be assumed to be DNA.Diagnostic Error Messages None.Exit status 0 if successful.Known bugs None.See also Program name Description banana Bending and curvature plot in B-DNA btwisted Calculates the twisting in a B-DNA sequence chaos Create a chaos game representation plot for a sequence compseq Count composition of dimer/trimer/etc words in a sequence freak Residue/base frequency table or plot isochore Plots isochores in large DNA sequences sirna Finds siRNA duplexes in mRNA wordcount Counts words of a specified size in a DNA sequenceAuthor(s) This program was originally included in EGCG under the names "MELT" and "MELTPLOT", written by Rodrigo Lopez (rls ⌨️ 快捷键说明
复制代码
Ctrl + C
搜索代码
Ctrl + F
全屏模式
F11
切换主题
Ctrl + Shift + D
显示快捷键
?
增大字号
Ctrl + =
减小字号
Ctrl + -