extractfeat.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 984 行 · 第 1/3 页

TXT
984
字号
>AP000504_66908_67344 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cccaggcagc>AP000504_71741_72164 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.actgtggaat>AP000504_72744_73649 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.tttaccataa>AP000504_73962_74192 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcatggcct>AP000504_74520_74709 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cctacctggg>AP000504_74856_74931 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcaccaatg>AP000504_75374_75489 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcaccatct>AP000504_76058_76160 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcaccaggc>AP000504_77125_77207 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcacttcac>AP000504_77820_78148 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcaccggct>AP000504_79023_79187 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.tgattagaat>AP000504_79451_80175 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.agcaggtctc>AP000504_81318_81943 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.tgcaggtctc>AP000504_83295_85730 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ggctccccaa>AP000504_85819_85964 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.gagatgagga>AP000504_86305_86403 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cttaccttga>AP000504_86550_86648 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcactgtag>AP000504_86730_86803 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ccaaccttca>AP000504_87402_87556 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ctcacatgcg>AP000504_87948_88090 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.catacctcct>AP000504_91393_91628 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ccccgggcga>AP000504_92264_92384 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.tttagagacc>AP000504_94413_94530 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ttcagatgaa>AP000504_94645_94841 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.tgcagatgtt>AP000504_95076_95129 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cccagagtga>AP000504_95289_95363 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.tgtagagtga>AP000504_96214_96449 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ttcagtgtcg>AP000504_97518_97647 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cacagccatc>AP000504_98437_98634 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cgcagcacga>AP000504_98843_99095 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.ttcagatcaa>AP000504_99439_99516 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cccagattct>AP000504_99847_99959 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20.cacaggacag>AB000360_808_2266 [exon] Homo sapiens PIGC gene, complete cds.cttttagtaa>HSHBB_19289_19632 [exon] Human beta globin region on chromosome 11.ggagccaaca>HSHBB_19755_19977 [exon] Human beta globin region on chromosome 11.catagactcc>HSHBB_20833_21080 [exon] Human beta globin region on chromosome 11.aacagctcct>HSHBB_34478_34622 [exon] Human beta globin region on chromosome 11.tccacacact>HSHBB_34745_34967 [exon] Human beta globin region on chromosome 11.cacaggctcc>HSHBB_35854_36069 [exon] Human beta globin region on chromosome 11.aacagctcct>HSHBB_39414_39558 [exon] Human beta globin region on chromosome 11.tccacacact>HSHBB_39681_39903 [exon] Human beta globin region on chromosome 11.cacaggctcc>HSHBB_40770_40985 [exon] Human beta globin region on chromosome 11.aacagctcct>HSHBB_45710_45800 [exon] Human beta globin region on chromosome 11.acactgtagt>HSHBB_45922_46145 [exon] Human beta globin region on chromosome 11.cacagtctcc>HSHBB_46997_47124 [exon] Human beta globin region on chromosome 11.cccagctctt>HSHBB_54740_54881 [exon] Human beta globin region on chromosome 11.tgcttacact>HSHBB_55010_55232 [exon] Human beta globin region on chromosome 11.ctcagattac>HSHBB_56131_56389 [exon] Human beta globin region on chromosome 11.cgcagctctt>HSHBB_62137_62278 [exon] Human beta globin region on chromosome 11.tgcttacatt>HSHBB_62187_62278 [exon] Human beta globin region on chromosome 11.acaccatggt>HSHBB_62390_62408 [exon] Human beta globin region on chromosome 11.attggtctat>HSHBB_62409_62631 [exon] Human beta globin region on chromosome 11.cttaggctgc>HSHBB_63482_63742 [exon] Human beta globin region on chromosome 11.cacagctcct>GMGL01_363_460 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).gaaatatggg>GMGL01_555_663 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected).aataggatat>GMGL01_2182_2286 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNAdetected).tgtaggtgcg>GMGL01_3065_3208 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNAdetected).cgtaggtggt   Example 4   To extract the CDS region with the exons joined into one sequence:% extractfeat tembl:hsfau1 -type CDS -join stdout Extract features from a sequence>HSFAU1_782_1912 [CDS] H.sapiens fau 1 geneatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaa   Example 5   To write out the 7 residues around all phosphorylated residues in the   tsw database:% extractfeat tsw:*  -type mod_res -value phosphorylation* -before 3 -after -4stdout Extract features from a sequence>OPSD_HUMAN_343_343 [mod_res] RHODOPSIN.TETSQVA>PAXI_HUMAN_118_118 [mod_res] PAXILLIN.EHVYSFP   Go to the input files for this exampleCommand line arguments   Standard (Mandatory) qualifiers:  [-sequence]          seqall     Sequence(s) filename and optional format, or                                  reference (input USA)  [-outseq]            seqout     [.] Sequence filename and                                  optional format (output USA)   Additional (Optional) qualifiers:   -before             integer    [0] If this value is greater than 0 then                                  that number of bases or residues before the                                  feature are included in the extracted                                  sequence. This allows you to get the context                                  of the feature. If this value is negative                                  then the start of the extracted sequence                                  will be this number of bases/residues before                                  the end of the feature. So a value of '10'                                  will start the extraction 10 bases/residues                                  before the start of the sequence, and a                                  value of '-10' will start the extraction 10                                  bases/residues before the end of the                                  feature. The output sequence will be padded                                  with 'N' or 'X' characters if the sequence                                  starts after the required start of the                                  extraction. (Any integer value)   -after              integer    [0] If this value is greater than 0 then                                  that number of bases or residues after the                                  feature are included in the extracted                                  sequence. This allows you to get the context                                  of the feature. If this value is negative                                  then the end of the extracted sequence will                                  be this number of bases/residues after the                                  start of the feature. So a value of '10'                                  will end the extraction 10 bases/residues                                  after the end of the sequence, and a value                                  of '-10' will end the extraction 10                                  bases/residues after the start of the                                  feature. The output sequence will be padded                                  with 'N' or 'X' characters if the sequence                                  ends before the required end of the                                  extraction. (Any integer value)   -source             string     [*] By default any feature source in the                                  feature table is shown. You can set this to                                  match any feature source you wish to show.                                  The source name is usually either the name                                  of the program that detected the feature or                                  it is the feature table (eg: EMBL) that the                                  feature came from.                                  The source may be wildcarded by using '*'.                                  If you wish to show more than one source,                                  separate their names with the character '|',                                  eg:                                  gene* | embl (Any string is accepted)   -type               string     [*] By default every feature in the feature                                  table is extracted. You can set this to be                                  any feature type you wish to extract.                                  See http://www3.ebi.ac.uk/Services/WebFeat/                                  for a list of the EMBL feature types and see                                  Appendix A of the Swissprot user manual in                                  http://www.expasy.ch/txt/userman.txt for a                                  list of the Swissprot feature types.                                  The type may be wildcarded by using '*'.                                  If you wish to extract more than one type,                                  separate their names with the character '|',                                  eg:                                  *UTR | intron (Any string is accepted)   -sense              integer    [0 - any sense, 1 - forward sense, -1 -                                  reverse sense] By default any feature type                                  in the feature table is extracted. You can                                  set this to match any feature sense you                                  wish. 0 - any sense, 1 - forward sense, -1 -                                  reverse sense (Any integer value)   -minscore           float      [0.0] If this is greater than or equal to                                  the maximum score, then any score is                                  permitted (Any numeric value)   -maxscore           float      [0.0] If this is less than or equal to the                                  maximum score, then any score is permitted                                  (Any numeric value)   -tag                string     [*] Tags are the types of extra values that                                  a feature may have. For example in the EMBL                                  feature table, a 'CDS' type of feature may                                  have the tags '/codon', '/codon_start',                                  '/db_xref', '/EC_number', '/evidence',                                  '/exception', '/function', '/gene',                                  '/label', '/map', '/note', '/number',                                  '/partial', '/product', '/protein_id',                                  '/pseudo', '/standard_name', '/translation',                                  '/transl_except', '/transl_table', or                                  '/usedin'. Some of these tags also have                                  values, for example '/gene' can have the                                  value of the gene name.                                  By default any feature tag in the feature                                  table is extracted. You can set this to                                  match any feature tag you wish to show.                                  The tag may be wildcarded by using '*'.                                  If you wish to extract more than one tag,                                  separate their names with the character '|',                                  eg:                                  gene | label (Any string is accepted)   -value              string     [*] Tag values are the values associated                                  with a feature tag. Tags are the types of                                  extra values that a feature may have. For                                  example in the EMBL feature table, a 'CDS'                                  type of feature may have the tags '/codon',                                  '/codon_start', '/db_xref', '/EC_number',                                  '/evidence', '/exception', '/function',                                  '/gene', '/label', '/map', '/note',                                  '/number', '/partial', '/product',                                  '/protein_id', '/pseudo', '/standard_name',                                  '/translation', '/transl_except',                                  '/transl_table', or '/usedin'. Only some of                                  these tags can have values, for example                                  '/gene' can have the value of the gene name.                                  By default any feature tag value in the                                  feature table is shown. You can set this to                                  match any feature tag valueyou wish to show.                                  The tag value may be wildcarded by using                                  '*'.                                  If you wish to show more than one tag value,                                  separate their names with a space or the                                  character '|', eg:                                  pax* | 10 (Any string is accepted)   -join               boolean    [N] Some features, such as CDS (coding                                  sequence) and mRNA are composed of introns                                  concatenated together. There may be other                                  forms of 'joined' sequence, depending on the                                  feature table. If this option is set TRUE,                                  then any group of these features will be                                  output as a single sequence. If the 'before'                                  and 'after' qualifiers have been set, then                                  only the sequence before the first feature                                  and after the last feature are added.   -featinname         boolean    [N] To aid you in identifying the type of                                  feature that has been output, the type of                                  feature is added to the start of the                                  description of the output sequence.                                  Sometimes the description of a sequence is                                  lost in subsequent processing of the                                  sequences file, so it is useful for the type                                  to be a part of the sequence ID name. If                                  you set this to be TRUE then the name is                                  added to the ID name of the output sequence.   -describe           string     To aid you in identifying some further

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?