extractfeat.txt

emboss的linux版本的源代码

>AP000504_66908_67344 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cccaggcagc
>AP000504_71741_72164 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
actgtggaat
>AP000504_72744_73649 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
tttaccataa
>AP000504_73962_74192 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcatggcct
>AP000504_74520_74709 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cctacctggg
>AP000504_74856_74931 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcaccaatg
>AP000504_75374_75489 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcaccatct
>AP000504_76058_76160 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcaccaggc
>AP000504_77125_77207 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcacttcac
>AP000504_77820_78148 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcaccggct
>AP000504_79023_79187 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
tgattagaat
>AP000504_79451_80175 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
agcaggtctc
>AP000504_81318_81943 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
tgcaggtctc
>AP000504_83295_85730 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ggctccccaa
>AP000504_85819_85964 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
gagatgagga
>AP000504_86305_86403 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cttaccttga
>AP000504_86550_86648 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcactgtag
>AP000504_86730_86803 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ccaaccttca
>AP000504_87402_87556 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ctcacatgcg
>AP000504_87948_88090 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
catacctcct
>AP000504_91393_91628 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ccccgggcga
>AP000504_92264_92384 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
tttagagacc
>AP000504_94413_94530 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ttcagatgaa
>AP000504_94645_94841 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
tgcagatgtt
>AP000504_95076_95129 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cccagagtga
>AP000504_95289_95363 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
tgtagagtga
>AP000504_96214_96449 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ttcagtgtcg
>AP000504_97518_97647 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cacagccatc
>AP000504_98437_98634 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cgcagcacga
>AP000504_98843_99095 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
ttcagatcaa
>AP000504_99439_99516 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cccagattct
>AP000504_99847_99959 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA C
lass I region, section 3/20.
cacaggacag
>AB000360_808_2266 [exon] Homo sapiens PIGC gene, complete cds.
cttttagtaa
>HSHBB_19289_19632 [exon] Human beta globin region on chromosome 11.
ggagccaaca
>HSHBB_19755_19977 [exon] Human beta globin region on chromosome 11.
catagactcc
>HSHBB_20833_21080 [exon] Human beta globin region on chromosome 11.
aacagctcct
>HSHBB_34478_34622 [exon] Human beta globin region on chromosome 11.
tccacacact
>HSHBB_34745_34967 [exon] Human beta globin region on chromosome 11.
cacaggctcc
>HSHBB_35854_36069 [exon] Human beta globin region on chromosome 11.
aacagctcct
>HSHBB_39414_39558 [exon] Human beta globin region on chromosome 11.
tccacacact
>HSHBB_39681_39903 [exon] Human beta globin region on chromosome 11.
cacaggctcc
>HSHBB_40770_40985 [exon] Human beta globin region on chromosome 11.
aacagctcct
>HSHBB_45710_45800 [exon] Human beta globin region on chromosome 11.
acactgtagt
>HSHBB_45922_46145 [exon] Human beta globin region on chromosome 11.
cacagtctcc
>HSHBB_46997_47124 [exon] Human beta globin region on chromosome 11.
cccagctctt
>HSHBB_54740_54881 [exon] Human beta globin region on chromosome 11.
tgcttacact
>HSHBB_55010_55232 [exon] Human beta globin region on chromosome 11.
ctcagattac
>HSHBB_56131_56389 [exon] Human beta globin region on chromosome 11.
cgcagctctt
>HSHBB_62137_62278 [exon] Human beta globin region on chromosome 11.
tgcttacatt
>HSHBB_62187_62278 [exon] Human beta globin region on chromosome 11.
acaccatggt
>HSHBB_62390_62408 [exon] Human beta globin region on chromosome 11.
attggtctat
>HSHBB_62409_62631 [exon] Human beta globin region on chromosome 11.
cttaggctgc
>HSHBB_63482_63742 [exon] Human beta globin region on chromosome 11.
cacagctcct
>GMGL01_363_460 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA de
tected).
gaaatatggg
>GMGL01_555_663 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA de
tected).
aataggatat
>GMGL01_2182_2286 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA
detected).
tgtaggtgcg
>GMGL01_3065_3208 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA
detected).
cgtaggtggt

   Example 4

   To extract the CDS region with the exons joined into one sequence:


% extractfeat tembl:hsfau1 -type CDS -join stdout 
Extract features from a sequence

>HSFAU1_782_1912 [CDS] H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa

   Example 5

   To write out the 7 residues around all phosphorylated residues in the
   tsw database:


% extractfeat tsw:*  -type mod_res -value phosphorylation* -before 3 -after -4
stdout 
Extract features from a sequence

>OPSD_HUMAN_343_343 [mod_res] RHODOPSIN.
TETSQVA
>PAXI_HUMAN_118_118 [mod_res] PAXILLIN.
EHVYSFP

   Go to the input files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -before             integer    [0] If this value is greater than 0 then
                                  that number of bases or residues before the
                                  feature are included in the extracted
                                  sequence. This allows you to get the context
                                  of the feature. If this value is negative
                                  then the start of the extracted sequence
                                  will be this number of bases/residues before
                                  the end of the feature. So a value of '10'
                                  will start the extraction 10 bases/residues
                                  before the start of the sequence, and a
                                  value of '-10' will start the extraction 10
                                  bases/residues before the end of the
                                  feature. The output sequence will be padded
                                  with 'N' or 'X' characters if the sequence
                                  starts after the required start of the
                                  extraction. (Any integer value)
   -after              integer    [0] If this value is greater than 0 then
                                  that number of bases or residues after the
                                  feature are included in the extracted
                                  sequence. This allows you to get the context
                                  of the feature. If this value is negative
                                  then the end of the extracted sequence will
                                  be this number of bases/residues after the
                                  start of the feature. So a value of '10'
                                  will end the extraction 10 bases/residues
                                  after the end of the sequence, and a value
                                  of '-10' will end the extraction 10
                                  bases/residues after the start of the
                                  feature. The output sequence will be padded
                                  with 'N' or 'X' characters if the sequence
                                  ends before the required end of the
                                  extraction. (Any integer value)
   -source             string     [*] By default any feature source in the
                                  feature table is shown. You can set this to
                                  match any feature source you wish to show.
                                  The source name is usually either the name
                                  of the program that detected the feature or
                                  it is the feature table (eg: EMBL) that the
                                  feature came from.
                                  The source may be wildcarded by using '*'.
                                  If you wish to show more than one source,
                                  separate their names with the character '|',
                                  eg:
                                  gene* | embl (Any string is accepted)
   -type               string     [*] By default every feature in the feature
                                  table is extracted. You can set this to be
                                  any feature type you wish to extract.
                                  See http://www3.ebi.ac.uk/Services/WebFeat/
                                  for a list of the EMBL feature types and see
                                  Appendix A of the Swissprot user manual in
                                  http://www.expasy.ch/txt/userman.txt for a
                                  list of the Swissprot feature types.
                                  The type may be wildcarded by using '*'.
                                  If you wish to extract more than one type,
                                  separate their names with the character '|',
                                  eg:
                                  *UTR | intron (Any string is accepted)
   -sense              integer    [0 - any sense, 1 - forward sense, -1 -
                                  reverse sense] By default any feature type
                                  in the feature table is extracted. You can
                                  set this to match any feature sense you
                                  wish. 0 - any sense, 1 - forward sense, -1 -
                                  reverse sense (Any integer value)
   -minscore           float      [0.0] If this is greater than or equal to
                                  the maximum score, then any score is
                                  permitted (Any numeric value)
   -maxscore           float      [0.0] If this is less than or equal to the
                                  maximum score, then any score is permitted
                                  (Any numeric value)
   -tag                string     [*] Tags are the types of extra values that
                                  a feature may have. For example in the EMBL
                                  feature table, a 'CDS' type of feature may
                                  have the tags '/codon', '/codon_start',
                                  '/db_xref', '/EC_number', '/evidence',
                                  '/exception', '/function', '/gene',
                                  '/label', '/map', '/note', '/number',
                                  '/partial', '/product', '/protein_id',
                                  '/pseudo', '/standard_name', '/translation',
                                  '/transl_except', '/transl_table', or
                                  '/usedin'. Some of these tags also have
                                  values, for example '/gene' can have the
                                  value of the gene name.
                                  By default any feature tag in the feature
                                  table is extracted. You can set this to
                                  match any feature tag you wish to show.
                                  The tag may be wildcarded by using '*'.
                                  If you wish to extract more than one tag,
                                  separate their names with the character '|',
                                  eg:
                                  gene | label (Any string is accepted)
   -value              string     [*] Tag values are the values associated
                                  with a feature tag. Tags are the types of
                                  extra values that a feature may have. For
                                  example in the EMBL feature table, a 'CDS'
                                  type of feature may have the tags '/codon',
                                  '/codon_start', '/db_xref', '/EC_number',
                                  '/evidence', '/exception', '/function',
                                  '/gene', '/label', '/map', '/note',
                                  '/number', '/partial', '/product',
                                  '/protein_id', '/pseudo', '/standard_name',
                                  '/translation', '/transl_except',
                                  '/transl_table', or '/usedin'. Only some of
                                  these tags can have values, for example
                                  '/gene' can have the value of the gene name.
                                  By default any feature tag value in the
                                  feature table is shown. You can set this to
                                  match any feature tag valueyou wish to show.
                                  The tag value may be wildcarded by using
                                  '*'.
                                  If you wish to show more than one tag value,
                                  separate their names with a space or the
                                  character '|', eg:
                                  pax* | 10 (Any string is accepted)
   -join               boolean    [N] Some features, such as CDS (coding
                                  sequence) and mRNA are composed of introns
                                  concatenated together. There may be other
                                  forms of 'joined' sequence, depending on the
                                  feature table. If this option is set TRUE,
                                  then any group of these features will be
                                  output as a single sequence. If the 'before'
                                  and 'after' qualifiers have been set, then
                                  only the sequence before the first feature
                                  and after the last feature are added.
   -featinname         boolean    [N] To aid you in identifying the type of
                                  feature that has been output, the type of
                                  feature is added to the start of the
                                  description of the output sequence.
                                  Sometimes the description of a sequence is
                                  lost in subsequent processing of the
                                  sequences file, so it is useful for the type
                                  to be a part of the sequence ID name. If
                                  you set this to be TRUE then the name is
                                  added to the ID name of the output sequence.
   -describe           string     To aid you in identifying some further