descseq.txt

emboss的linux版本的源代码

                                  descseq 



Function

   Alter the name or description of a sequence

Description

   Most sequence formats allow, at the very minimum, a name for the
   sequence and some comments to be stored in the sequence file.

   Rather than using an editor to alter the name or the comments, descseq
   allows you to simply change them and write out a new file with the
   changes in and the sequence left unaltered.

   The default action is to replace the existing name or description with
   your new one, but by using the qualifier '-append' what you enter is
   appended to the existing name or description.

   Note that if you append to a description, no space is inserted by
   default bewteen the existing description and your appended text. You
   have to put in a space yourself if you require one.

Usage

   Here is a sample session with descseq

   Set the name of a sequence to "myclone23"


% descseq -seq dna.text -out clone23.seq -name "myclone23" 
Alter the name or description of a sequence.

   Go to the input files for this example
   Go to the output files for this example

   Example 2

   Set the description of a sequence to "This is my clone number 244"


% descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" 
Alter the name or description of a sequence.

   Go to the output files for this example

   Example 3

   Append some text to the description of a sequence


% descseq -seq dna.text -out est4.seq -desc " (submitted)" -append 
Alter the name or description of a sequence.

   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -name               string     Name of the sequence (Any string is
                                  accepted)
   -description        string     Description of the sequence (Any string is
                                  accepted)

   Advanced (Unprompted) qualifiers:
   -append             boolean    [N] This allows you to append the name or
                                  description you have given on to the end of
                                  the existing name or description of the
                                  sequence.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   descseq reads a normal sequence USA.

  Input files for usage example

  File: dna.text

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output file format

   descseq writes the sequence file with a changed name or description.

  Output files for usage example

  File: clone23.seq

>myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

  Output files for usage example 2

  File: xy24.seq

>EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

  Output files for usage example 3

  File: est4.seq

>EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

   None.

Notes

   None.

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with status 0.

Known bugs

   None noted.

See also

   Program name                         Description
   biosed       Replace or delete sequence sections
   codcopy      Reads and writes a codon usage table
   cutseq       Removes a specified section from a sequence
   degapseq     Removes gap characters from sequences
   entret       Reads and writes (returns) flatfile entries
   extractalign Extract regions from a sequence alignment
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Write a list file of the logical OR of two sets of sequences
   makenucseq   Creates random nucleotide sequences
   makeprotseq  Creates random protein sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Exclude a set of sequences and write out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   union        Reads sequence fragments and builds one sequence
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file

Author(s)

   Gary Williams (gwilliam