listor.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 305 行

TXT
305
字号
                                  listor Function   Write a list file of the logical OR of two sets of sequencesDescription   listor reads in two sets of sequences and writes out a list file (file   of file names) that result from the logical union of these two sets of   sequences. It is a simple way of manipulating and editing lists or   sets of sequences to produce a list file.   When comparing sequences to see if they are the same between two sets   of sequences, no use is made of the ID name or accession number of the   sequences. Only the sequences themselves are compared. The comparison   of the sequences is case-independent.   The logical union is an OR operation by default. Other available   operations are: AND, XOR and NOT.   The (default) logical OR of the two sets of sequences is simply the   result of merging the two sets of sequences, (without listing any   shared sequences twice).   A logical AND simply lists those sequences that occur in both sets of   sequences.   A logical XOR lists those sequences that ONLY occur in the first set   or only occur in the second set - sequences occuring in both sets are   ignored (the opposite of an AND).   A logical NOT lists all those sequences in the first set except for   those that also occur in the second set.Usage   Here is a sample session with listor   Write the logical OR of two lists:% listor ../data/file2 Write a list file of the logical OR of two sets of sequencesList of USAs output file [file1.list]:    Go to the input files for this example   Go to the output files for this example   Example 2   Write the logical AND of two lists:% listor ../data/file2 -operator and Write a list file of the logical OR of two sets of sequencesList of USAs output file [file1.list]:    Go to the output files for this example   Example 3   Write the logical XOR of two lists:% listor ../data/file2 -operator xor Write a list file of the logical OR of two sets of sequencesList of USAs output file [file1.list]:    Go to the output files for this example   Example 4   Write the logical NOT of two lists:% listor ../data/file2 -operator not Write a list file of the logical OR of two sets of sequencesList of USAs output file [file1.list]:    Go to the output files for this exampleCommand line arguments   Standard (Mandatory) qualifiers:  [-firstsequences]    seqset     Sequence set filename and optional format,                                  or reference (input USA)  [-secondsequences]   seqset     Sequence set filename and optional format,                                  or reference (input USA)  [-outfile]           outfile    [*.listor] The list of sequence names will                                  be written to this list file   Additional (Optional) qualifiers:   -operator           menu       [OR] The following logical operators combine                                  the sequences in the following ways:                                  OR - gives all that occur in one set or the                                  other                                  AND - gives only those which occur in both                                  sets                                  XOR - gives those which only occur in one                                  set or the other, but not in both                                  NOT - gives those which occur in the first                                  set except for those that also occur in the                                  second (Values: O (OR - merger of both                                  sets); A (AND - only those in both sets); X                                  (XOR - only those not in both sets); N (NOT                                  - those of the first set that are not in the                                  second))   Advanced (Unprompted) qualifiers: (none)   Associated qualifiers:   "-firstsequences" associated qualifiers   -sbegin1            integer    Start of each sequence to be used   -send1              integer    End of each sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-secondsequences" associated qualifiers   -sbegin2            integer    Start of each sequence to be used   -send2              integer    End of each sequence to be used   -sreverse2          boolean    Reverse (if DNA)   -sask2              boolean    Ask for begin/end/reverse   -snucleotide2       boolean    Sequence is nucleotide   -sprotein2          boolean    Sequence is protein   -slower2            boolean    Make lower case   -supper2            boolean    Make upper case   -sformat2           string     Input sequence format   -sdbname2           string     Database name   -sid2               string     Entryname   -ufo2               string     UFO features   -fformat2           string     Features format   -fopenfile2         string     Features file name   "-outfile" associated qualifiers   -odirectory3        string     Output directory   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format   The input sets of sequences can be of any valid USAs. The program was   written to perform logical operations on list files, but in practice,   wildcarded database entries and file names are also perfectly legal   specifications of the input sequences.  Input files for usage example  File: file1>onetagctagcg>twotagctagcggctacgt>threetagctattttatgctacgtcagtgac  File: file2>twotagctagcggctacgt>threetagctattttatgctacgtcagtgac>fourgcgcggcgcgcgtgcgtcgttgctggggcccOutput file format   The ouput is simply a list of the USAs (format and sequence   specification) resulting from the required logical union of the two   sets of input sequence.   The order that the USAs are written out is not necessarily the same as   the order of either of the input sets of sequences.   The results of the four types of logical union follows. Note that the   duplicated sequences in these two files have been given the same name.   This is not necessary for the operation of listor as it compares the   sequences themselves, not the ID names of the sequences.  Output files for usage example  File: file1.listfasta::../../data/file1:onefasta::../../data/file1:twofasta::../../data/file1:threefasta::../../data/file2:four  Output files for usage example 2  File: file1.listfasta::../../data/file1:twofasta::../../data/file1:three  Output files for usage example 3  File: file1.listfasta::../../data/file1:onefasta::../../data/file2:four  Output files for usage example 4  File: file1.list   fasta::../../data/file1:oneData files   None.Notes   The program stores all of the input sequences in memory while it is   working out the logical unions of the two sets of sequences. This   means that it is restricted by the available memory. Doing logical   unions involving all of the sequences in large databases, such as   EMBL, is probably impractical unless you are lucky enough to have   extraordinary amounts of memory on your machine.References   None.Warnings   If you try to do a logical union with all of the sequences in EMBL and   another sequence set, this program will attempt to read all of the   EMBL sequences into memory at once. This will probably not succeed.Diagnostic Error Messages   None.Exit status   It always exits with status 0.Known bugs   None.See also   Program name                         Description   biosed       Replace or delete sequence sections   codcopy      Reads and writes a codon usage table   cutseq       Removes a specified section from a sequence   degapseq     Removes gap characters from sequences   descseq      Alter the name or description of a sequence   entret       Reads and writes (returns) flatfile entries   extractalign Extract regions from a sequence alignment   extractfeat  Extract features from a sequence   extractseq   Extract regions from a sequence   makenucseq   Creates random nucleotide sequences   makeprotseq  Creates random protein sequences   maskfeat     Mask off features of a sequence   maskseq      Mask off regions of a sequence   newseq       Type in a short new sequence   noreturn     Removes carriage return from ASCII files   notseq       Exclude a set of sequences and write out the remaining ones   nthseq       Writes one sequence from a multiple set of sequences   pasteseq     Insert one sequence into another   revseq       Reverse and complement a sequence   seqret       Reads and writes (returns) sequences   seqretsplit  Reads and writes (returns) sequences in individual files   skipseq      Reads and writes (returns) sequences, skipping first few   splitter     Split a sequence into (overlapping) smaller sequences   trimest      Trim poly-A tails off EST sequences   trimseq      Trim ambiguous bits off the ends of sequences   union        Reads sequence fragments and builds one sequence   vectorstrip  Strips out DNA between a pair of vector sequences   yank         Reads a sequence range, appends the full USA to a list fileAuthor(s)   Gary Williams (gwilliam 

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?