wordfinder.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 534 行 · 第 1/2 页

TXT
534
字号
0     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      6480     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      6540     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      6600     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      6660     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      6720     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      6780     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      6840     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      6900     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      6960     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      7020     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      7080     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      7140     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      7200     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      7260     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      7320     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      7380     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      7440     cagcccgccc atggtaacca ccggcagagc ggtcgac                               7477//Output file format   The output is a standard EMBOSS alignment file.   The results can be output in one of several styles by using the   command-line qualifier -aformat xxx, where 'xxx' is replaced by the   name of the required format. Some of the alignment formats can cope   with an unlimited number of sequences, while others are only for pairs   of sequences.   The available multiple alignment format names are: unknown, multiple,   simple, fasta, msf, trace, srs   The available pairwise alignment format names are: pair, markx0,   markx1, markx2, markx3, markx10, srspair, score   See: http://emboss.sf.net/docs/themes/AlignFormats.html for further   information on alignment formats.   The output alignment is in simple format by default.  Output files for usage example  File: wordfinder.error  File: eclac.wordfinder######################################### Program: wordfinder# Rundate: Sat 15 Jul 2006 12:00:00# Commandline: wordfinder#    [-asequence] tembl:eclac#    [-bsequence] "tembl:ec*"#    -wordlen 50#    -gapextend 3.0# Align_format: simple# Report_file: eclac.wordfinder#########################################=======================================## Aligned_sequences: 2# 1: ECLAC# 2: ECLAC# Matrix: EDNAFULL# Gap_penalty: 30.0# Extend_penalty: 3.0## Length: 7477# Identity:    7477/7477 (100.0%)# Similarity:  7477/7477 (100.0%)# Gaps:           0/7477 ( 0.0%)# Score: 37385.0## Wordscore:7477# Alignlength:7477##=======================================ECLAC              1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLAC              1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50ECLAC             51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLAC             51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100ECLAC            101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLAC            101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150ECLAC            151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLAC            151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200ECLAC            201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250                     ||||||||||||||||||||||||||||||||||||||||||||||||||  [Part of this file has been deleted for brevity]ECLAC           3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   3836                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   2550ECLAC           3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   3886                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   2600ECLAC           3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   3936                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   2650ECLAC           3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   3986                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   2700ECLAC           3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   4036                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   2750ECLAC           4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   4086                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   2800ECLAC           4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   4136                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   2850ECLAC           4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   4186                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   2900ECLAC           4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   4236                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   2950ECLAC           4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   4286                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   3000ECLAC           4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   4336                     ||||||||||||||||||||||||||||||||||||||||||||||||||ECLACZ          3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   3050ECLAC           4337 gttggtctggtgtcaaaaataataataa   4364                     ||||||||||||||||||||||||||||ECLACZ          3051 gttggtctggtgtcaaaaataataataa   3078#---------------------------------------#---------------------------------------   The file 'wordfinder.error' will contain any errors that occured   during the program. This may be that wordmatch could not find any   matches hence no suitable start point is found for the smith-waterman   calculation.Data files   For protein sequences EBLOSUM62 is used for the substitution matrix.   For nucleotide sequence, EDNAMAT is used. Others can be specified.   EMBOSS data files are distributed with the application and stored in   the standard EMBOSS data directory, which is defined by the EMBOSS   environment variable EMBOSS_DATA.   To see the available EMBOSS data files, run:% embossdata -showall   To fetch one of the data files (for example 'Exxx.dat') into your   current directory for you to inspect or modify, run:% embossdata -fetch -file Exxx.dat   Users can provide their own data files in their own directories.   Project specific files can be put in the current directory, or for   tidier directory listings in a subdirectory called ".embossdata".   Files for all EMBOSS runs can be put in the user's home directory, or   again in a subdirectory called ".embossdata".   The directories are searched in the following order:     * . (your current directory)     * .embossdata (under your current directory)     * ~/ (your home directory)     * ~/.embossdataNotes   The time this program takes to do an alignment depends very much on   the word size. For short sequences a short word size (e.g. 4) can make   it take a very long time. Large word sizes (e.g. 30) for sequences   that are very similar give a very quick result. The default of 16   should give reasonable fast alignments.   Because it does a Smith & Waterman alignment (albeit in a narrow   region around the diagonal shown to be the 'best' by a word match),   this program can use huge amounts of memory if the sequences are   large.   Because the alignment is made within a narrow area each side of the   'best' diagonal, if there are sufficient indels between the two   sequences, then the path of the Smith & Waterman alignment can wander   outside of this area. Making the width larger can avoid this problem,   but you then use more memory.   The longer the sequences and the wider the specified alignment width,   the more memory will be used.   If the program terminates due to lack of memory you can try the   following:   Run the UNIX command 'limit' to see if your stack or memory usage have   been limited and if so, run 'unlimit', (e.g.: '% unlimit stacksize').References   None.Warnings   None.Diagnostic Error Messages   None.Exit status   It always exits with a status of 0.Known bugs   None.See also   Program name                         Description   matcher      Finds the best local alignments between two sequences   seqmatchall  All-against-all comparison of a set of sequences   supermatcher Match large sequences against one or more other sequences   water        Smith-Waterman local alignment   wordmatch    Finds all exact matches of a given size between 2 sequencesAuthor(s)   Ian Longden (il 

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?