supermatcher.txt

emboss的linux版本的源代码

     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      666
0
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      672
0
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      678
0
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      684
0
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      690
0
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      696
0
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      702
0
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      708
0
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      714
0
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      720
0
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      726
0
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      732
0
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      738
0
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      744
0
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               747
7
//

Output file format

   The output is a standard EMBOSS alignment file.

   The results can be output in one of several styles by using the
   command-line qualifier -aformat xxx, where 'xxx' is replaced by the
   name of the required format. Some of the alignment formats can cope
   with an unlimited number of sequences, while others are only for pairs
   of sequences.

   The available multiple alignment format names are: unknown, multiple,
   simple, fasta, msf, trace, srs

   The available pairwise alignment format names are: pair, markx0,
   markx1, markx2, markx3, markx10, srspair, score

   See: http://emboss.sf.net/docs/themes/AlignFormats.html for further
   information on alignment formats.

   The output alignment is in simple format by default.

  Output files for usage example

  File: supermatcher.error

  File: eclac.supermatcher

########################################
# Program: supermatcher
# Rundate: Sat 15 Jul 2006 12:00:00
# Commandline: supermatcher
#    [-asequence] "tembl:ec*"
#    [-bsequence] tembl:eclac
#    -wordlen 50
#    -gapextend 3.0
# Align_format: simple
# Report_file: eclac.supermatcher
########################################

#=======================================
#
# Aligned_sequences: 2
# 1: ECLAC
# 2: ECLAC
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 3.0
#
# Length: 7477
# Identity:    7477/7477 (100.0%)
# Similarity:  7477/7477 (100.0%)
# Gaps:           0/7477 ( 0.0%)
# Score: 37385.0
#
#
#=======================================

ECLAC              1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC              1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50

ECLAC             51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC             51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100

ECLAC            101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC            101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150

ECLAC            151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC            151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200

ECLAC            201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC            201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250



  [Part of this file has been deleted for brevity]

ECLACZ          2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   2550
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   3836

ECLACZ          2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   2600
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   3886

ECLACZ          2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   2650
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   3936

ECLACZ          2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   2700
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   3986

ECLACZ          2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   2750
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   4036

ECLACZ          2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   2800
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   4086

ECLACZ          2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   2850
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   4136

ECLACZ          2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   2900
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   4186

ECLACZ          2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   2950
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   4236

ECLACZ          2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   3000
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   4286

ECLACZ          3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   3050
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   4336

ECLACZ          3051 gttggtctggtgtcaaaaataataataa   3078
                     ||||||||||||||||||||||||||||
ECLAC           4337 gttggtctggtgtcaaaaataataataa   4364


#---------------------------------------
#---------------------------------------

   The file 'supermatcher.error' will contain any errors that occured
   during the program. This may be that wordmatch could not find any
   matches hence no suitable start point is found for the smith-waterman
   calculation.

Data files

   For protein sequences EBLOSUM62 is used for the substitution matrix.
   For nucleotide sequence, EDNAMAT is used. Others can be specified.

   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.

   To see the available EMBOSS data files, run:

% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".

   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata

Notes

   The time this program takes to do an alignment depends very much on
   the word size. For short sequences a short word size (e.g. 4) can make
   it take a very long time. Large word sizes (e.g. 30) for sequences
   that are very similar give a very quick result. The default of 16
   should give reasonable fast alignments.

   Because it does a Smith & Waterman alignment (albeit in a narrow
   region around the diagonal shown to be the 'best' by a word match),
   this program can use huge amounts of memory if the sequences are
   large.

   Because the alignment is made within a narrow area each side of the
   'best' diagonal, if there are sufficient indels between the two
   sequences, then the path of the Smith & Waterman alignment can wander
   outside of this area. Making the width larger can avoid this problem,
   but you then use more memory.

   The longer the sequences and the wider the specified alignment width,
   the more memory will be used.

   If the program terminates due to lack of memory you can try the
   following:

   Run the UNIX command 'limit' to see if your stack or memory usage have
   been limited and if so, run 'unlimit', (e.g.: '% unlimit stacksize').

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with a status of 0.

Known bugs

   None.

See also

   Program name                         Description
   matcher      Finds the best local alignments between two sequences
   seqmatchall  All-against-all comparison of a set of sequences
   water        Smith-Waterman local alignment
   wordfinder   Match large sequences against one or more other sequences
   wordmatch    Finds all exact matches of a given size between 2 sequences

Author(s)

   Ian Longden (il