vectorstrip.txt
来自「emboss的linux版本的源代码」· 文本 代码 · 共 338 行
TXT
338 行
vectorstrip Function Strips out DNA between a pair of vector sequencesDescription vectorstrip is intended to be useful for stripping vector sequence from the ends of sequences of interest. For example, if a fragment has been cloned into a vector and then sequenced, the sequence may contain vector data eg from the cloning polylinker at the 5' and 3' ends of the sequence. vectorstrip will remove these contaminating regions and output trimmed sequence ready for input into another application. vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected. Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory. The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted. Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below.Usage Here is a sample session with vectorstrip% vectorstrip @vecseqs.list Strips out DNA between a pair of vector sequencesAre your vector sequences in a file? [Y]: Cloning vector definition file (optional): vectorsMax allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]: vector.stripoutput sequence(s) [pbluescript.fasta]: vector.fasta Go to the input files for this example Go to the output files for this exampleCommand line arguments Standard (Mandatory) qualifiers (* if not always prompted): [-sequence] seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) [-[no]vectorfile] toggle [Y] Are your vector sequences in a file?* -vectorsfile infile Cloning vector definition file (optional) -mismatch integer [10] Max allowed % mismatch (Any integer value) -[no]besthits boolean [Y] Show only the best hits (minimise mismatches)?* -linkera string The 5' sequence (Any string is accepted)* -linkerb string The 3' sequence (Any string is accepted) [-outfile] outfile [*.vectorstrip] Output file name [-outseq] seqoutall [.] Sequence set(s) filename and optional format (output USA) Additional (Optional) qualifiers: -allsequences boolean [N] Show all sequences in output Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory3 string Output directory "-outseq" associated qualifiers -osformat4 string Output seq format -osextension4 string File name extension -osname4 string Base file name -osdirectory4 string Output directory -osdbname4 string Database name to add -ossingle4 boolean Separate file for each entry -oufo4 string UFO features -offormat4 string Features format -ofname4 string Features file name -ofdirectory4 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messagesInput file format Input files for usage example File: vecseqs.list../../data/bluescript.seq../../data/litmus.seq../../data/pTYB1.seq File: vectors# Example vector file for use by vectorstrip# Vector 5' 3'pTYB1 GACGGCGGCCGCGAATTCC TCGAGGGCTCTTCCTGCpBS_KS+ GGGTACCGGGCCCCCCC TCGAGGTCGACGGTApLITMUS GATATCCTGCAGGAATTCC TCGAGACCGTACGTGCG The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen. Each line of the vector file should contain the name of the vector, the 5' pattern and the 3' pattern. Lines beginning with # are treated as comments and ignored. If only one vector sequence is given in the it will be assumed that this is the 5' pattern. If a vector name is given but no pattern data, the vector will not be used.Output file format Output files for usage example File: vector.stripSequence: pBlueScript Vector: pTYB1 No matchSequence: pBlueScript Vector: pBS_KS+5' sequence matches: From 67 to 83 with 0 mismatches3' sequence matches: From 205 to 219 with 0 mismatchesSequences output to file: from 84 to 204 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC sequence trimmed from 3' end: TCGAGGTCGACGGTATCGATAAGCTTGATATCGSequence: pBlueScript Vector: pLITMUS No matchSequence: litmus.seq Vector: pTYB1 No matchSequence: litmus.seq Vector: pBS_KS+ No matchSequence: litmus.seq Vector: pLITMUS5' sequence matches: From 43 to 61 with 0 mismatches3' sequence matches: From 183 to 199 with 0 mismatchesSequences output to file: from 62 to 182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT GCAGGAATTCC sequence trimmed from 3' end: TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG GCCTTAAGTGAGTCGTATTACGGASequence: pTYB1.seq Vector: pTYB15' sequence matches: From 40 to 58 with 0 mismatches3' sequence matches: From 180 to 196 with 0 mismatchesSequences output to file: from 59 to 179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG CGAATTCC sequence trimmed from 3' end: TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGATSequence: pTYB1.seq Vector: pBS_KS+ No matchSequence: pTYB1.seq Vector: pLITMUS No match File: vector.fasta>pBlueScript_from_84_to_204 KS+tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgacatgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatagc>litmus.seq_from_62_to_182tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgacatgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatagc>pTYB1.seq_from_59_to_179tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgacatgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatagc Two types of output file are produced: 1. The sequence file(s) - contain the trimmed subsequence(s) produced by vectorstrip either all in one file, or in separate files if the command line flag -ossingle is used. 2. Results summary fileData files None.Notes None.References None.Warnings None.Diagnostic Error Messages 1.No suitable vectors found - exiting indicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile. 2.Illegal pattern indicates that one of the vector patterns could not be compiled and therefore cannot be searched. 3.5' and 3' sequence matches are identical; inconclusive indicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert.Exit status It always exits with status 0.Known bugs None.See also Program name Description biosed Replace or delete sequence sections codcopy Reads and writes a codon usage table cutseq Removes a specified section from a sequence degapseq Removes gap characters from sequences descseq Alter the name or description of a sequence entret Reads and writes (returns) flatfile entries extractalign Extract regions from a sequence alignment extractfeat Extract features from a sequence extractseq Extract regions from a sequence listor Write a list file of the logical OR of two sets of sequences makenucseq Creates random nucleotide sequences makeprotseq Creates random protein sequences maskfeat Mask off features of a sequence maskseq Mask off regions of a sequence newseq Type in a short new sequence noreturn Removes carriage return from ASCII files notseq Exclude a set of sequences and write out the remaining ones nthseq Writes one sequence from a multiple set of sequences pasteseq Insert one sequence into another revseq Reverse and complement a sequence seqret Reads and writes (returns) sequences seqretsplit Reads and writes (returns) sequences in individual files skipseq Reads and writes (returns) sequences, skipping first few splitter Split a sequence into (overlapping) smaller sequences trimest Trim poly-A tails off EST sequences trimseq Trim ambiguous bits off the ends of sequences union Reads sequence fragments and builds one sequence yank Reads a sequence range, appends the full USA to a list fileAuthor(s)
⌨️ 快捷键说明
复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?