vectorstrip.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 338 行

TXT
338
字号
                                vectorstrip Function   Strips out DNA between a pair of vector sequencesDescription   vectorstrip is intended to be useful for stripping vector sequence   from the ends of sequences of interest. For example, if a fragment has   been cloned into a vector and then sequenced, the sequence may contain   vector data eg from the cloning polylinker at the 5' and 3' ends of   the sequence. vectorstrip will remove these contaminating regions and   output trimmed sequence ready for input into another application.   vectorstrip is suitable for use with low quality sequence data as it   can allow for mismatches between the sequence and the vector patterns   provided. You can specify the maximum level of mismatch expected.   Vector data can either be provided in a file or interactively. If   presented in a file, vectorstrip will search all input sequences with   all vectors listed in that file. The intention is that the user can   maintain a single file for use with vectorstrip, containing all the   linker sequences commonly used in the laboratory.   The two patterns for each vector are searched separately against the   sequence. Once the search is completed, each of the hits of the 5'   sequence is paired with each of the hits of the 3' sequence and the   resulting subsequences are output. For example, if the 5' sequence   matches the sequence from (a) position 30-60, and(b)position 70-100,   and the 3' sequence matches from 150-175, then two subsequences will   be output: from 61-149, and from 101-149. The lower the quality of the   sequence, the more likely multiple hits become if nonzero mismatches   are accepted.   Default behaviour is to report only the best matches between the   vector patterns and the sequence. This means that if you specify a   maximum mismatch level of 10%, but the vector patterns match the   sequence with zero mismatches, the search will stop and the program   will output only these "best" matches. If there are no perfect   matches, the program will try searching again allowing 1 mismatch,   then 2, and so on until either the patterns match the sequence or the   maximum specified mismatch level is exceeded. You can tell vectorstrip   to show all possible matches up to your specified maximum level, as   illustrated in the examples below.Usage   Here is a sample session with vectorstrip% vectorstrip @vecseqs.list Strips out DNA between a pair of vector sequencesAre your vector sequences in a file? [Y]: Cloning vector definition file (optional): vectorsMax allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]: vector.stripoutput sequence(s) [pbluescript.fasta]: vector.fasta   Go to the input files for this example   Go to the output files for this exampleCommand line arguments   Standard (Mandatory) qualifiers (* if not always prompted):  [-sequence]          seqall     Nucleotide sequence(s) filename and optional                                  format, or reference (input USA)  [-[no]vectorfile]    toggle     [Y] Are your vector sequences in a file?*  -vectorsfile        infile     Cloning vector definition file (optional)   -mismatch           integer    [10] Max allowed % mismatch (Any integer                                  value)   -[no]besthits       boolean    [Y] Show only the best hits (minimise                                  mismatches)?*  -linkera            string     The 5' sequence (Any string is accepted)*  -linkerb            string     The 3' sequence (Any string is accepted)  [-outfile]           outfile    [*.vectorstrip] Output file name  [-outseq]            seqoutall  [.] Sequence set(s)                                  filename and optional format (output USA)   Additional (Optional) qualifiers:   -allsequences       boolean    [N] Show all sequences in output   Advanced (Unprompted) qualifiers: (none)   Associated qualifiers:   "-sequence" associated qualifiers   -sbegin1            integer    Start of each sequence to be used   -send1              integer    End of each sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-outfile" associated qualifiers   -odirectory3        string     Output directory   "-outseq" associated qualifiers   -osformat4          string     Output seq format   -osextension4       string     File name extension   -osname4            string     Base file name   -osdirectory4       string     Output directory   -osdbname4          string     Database name to add   -ossingle4          boolean    Separate file for each entry   -oufo4              string     UFO features   -offormat4          string     Features format   -ofname4            string     Features file name   -ofdirectory4       string     Output directory   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format  Input files for usage example  File: vecseqs.list../../data/bluescript.seq../../data/litmus.seq../../data/pTYB1.seq  File: vectors# Example vector file for use by vectorstrip# Vector        5'                      3'pTYB1   GACGGCGGCCGCGAATTCC     TCGAGGGCTCTTCCTGCpBS_KS+ GGGTACCGGGCCCCCCC       TCGAGGTCGACGGTApLITMUS GATATCCTGCAGGAATTCC     TCGAGACCGTACGTGCG   The same fragment has been cloned into the XhoI site of the polylinker   of each vector. The cloned fragment is represented in lower case and   the vector sequence in upper case so the sequence trimming can be   readily seen.   Each line of the vector file should contain the name of the vector,   the 5' pattern and the 3' pattern.   Lines beginning with # are treated as comments and ignored.   If only one vector sequence is given in the it will be assumed that   this is the 5' pattern.   If a vector name is given but no pattern data, the vector will not be   used.Output file format  Output files for usage example  File: vector.stripSequence: pBlueScript    Vector: pTYB1  No matchSequence: pBlueScript    Vector: pBS_KS+5' sequence matches:        From 67 to 83 with 0 mismatches3' sequence matches:        From 205 to 219 with 0 mismatchesSequences output to file:        from 84 to 204                tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                cacagtgacatgagagacacagatatagagacagatagacgatagacaga                cagcatatatagacagatagc        sequence trimmed from 5' end:                GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT                AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC        sequence trimmed from 3' end:                TCGAGGTCGACGGTATCGATAAGCTTGATATCGSequence: pBlueScript    Vector: pLITMUS        No matchSequence: litmus.seq     Vector: pTYB1  No matchSequence: litmus.seq     Vector: pBS_KS+        No matchSequence: litmus.seq     Vector: pLITMUS5' sequence matches:        From 43 to 61 with 0 mismatches3' sequence matches:        From 183 to 199 with 0 mismatchesSequences output to file:        from 62 to 182                tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                cacagtgacatgagagacacagatatagagacagatagacgatagacaga                cagcatatatagacagatagc        sequence trimmed from 5' end:                TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT                GCAGGAATTCC        sequence trimmed from 3' end:                TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG                GCCTTAAGTGAGTCGTATTACGGASequence: pTYB1.seq      Vector: pTYB15' sequence matches:        From 40 to 58 with 0 mismatches3' sequence matches:        From 180 to 196 with 0 mismatchesSequences output to file:        from 59 to 179                tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                cacagtgacatgagagacacagatatagagacagatagacgatagacaga                cagcatatatagacagatagc        sequence trimmed from 5' end:                CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG                CGAATTCC        sequence trimmed from 3' end:                TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGATSequence: pTYB1.seq      Vector: pBS_KS+        No matchSequence: pTYB1.seq      Vector: pLITMUS        No match  File: vector.fasta>pBlueScript_from_84_to_204 KS+tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgacatgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatagc>litmus.seq_from_62_to_182tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgacatgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatagc>pTYB1.seq_from_59_to_179tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgacatgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatagc   Two types of output file are produced:    1. The sequence file(s) - contain the trimmed subsequence(s) produced       by vectorstrip either all in one file, or in separate files if the       command line flag -ossingle is used.    2. Results summary fileData files   None.Notes   None.References   None.Warnings   None.Diagnostic Error Messages    1.No suitable vectors found - exiting       indicates that the 5' and 3' patterns for the vectors were blank -       usually this is as a result of an empty vectorfile.    2.Illegal pattern       indicates that one of the vector patterns could not be compiled       and therefore cannot be searched.    3.5' and 3' sequence matches are identical; inconclusive       indicates that the 5' and 3' patterns provided were identical, and       that they only match the sequence once. Thus the program cannot       determine which part of the sequence is vector and which is       insert.Exit status   It always exits with status 0.Known bugs   None.See also   Program name                         Description   biosed       Replace or delete sequence sections   codcopy      Reads and writes a codon usage table   cutseq       Removes a specified section from a sequence   degapseq     Removes gap characters from sequences   descseq      Alter the name or description of a sequence   entret       Reads and writes (returns) flatfile entries   extractalign Extract regions from a sequence alignment   extractfeat  Extract features from a sequence   extractseq   Extract regions from a sequence   listor       Write a list file of the logical OR of two sets of sequences   makenucseq   Creates random nucleotide sequences   makeprotseq  Creates random protein sequences   maskfeat     Mask off features of a sequence   maskseq      Mask off regions of a sequence   newseq       Type in a short new sequence   noreturn     Removes carriage return from ASCII files   notseq       Exclude a set of sequences and write out the remaining ones   nthseq       Writes one sequence from a multiple set of sequences   pasteseq     Insert one sequence into another   revseq       Reverse and complement a sequence   seqret       Reads and writes (returns) sequences   seqretsplit  Reads and writes (returns) sequences in individual files   skipseq      Reads and writes (returns) sequences, skipping first few   splitter     Split a sequence into (overlapping) smaller sequences   trimest      Trim poly-A tails off EST sequences   trimseq      Trim ambiguous bits off the ends of sequences   union        Reads sequence fragments and builds one sequence   yank         Reads a sequence range, appends the full USA to a list fileAuthor(s)

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?