remap.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 962 行 · 第 1/3 页

TXT
962
字号
     HpaII          1   BsiSI   Ksp632I          1   Bsu6I      TaqI          1# Enzymes which cut less frequently than the MINCUTS criterion# Enzymes < MINCUTS Frequency   Isoschizomers# Enzymes which cut more frequently than the MAXCUTS criterion# Enzymes > MAXCUTS Frequency   Isoschizomers# Enzymes that do not cutAclI      BamHI     BceAI     BseYI     BsrI      ClaI      EcoRI     EcoRIIHaeIII    Hin4I     HindII    HindIII   KpnI      MaeII     NotI# No. of cutting enzymes which do not match the# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria0  Output files for usage example 3  File: eclac.remapECLACE.coli lactose operon with lacI, lacZ, lacY and lacA genes.                                                      HspAI                                                      Hin6I                 TaqI                                 HinP1I                 |  BsiYI                             | HhaI                 |  Bsc4I                             | Bsu6I                 |  |   HspAI                         | BssKI                 |  |   Hin6I                         | Ksp632I                 |  |   HinP1I                        | | HpaII                 |  |   | HhaI        AciI            | | BsiSI                 \  \   \ \           \               \ \ \          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt                   10        20        30        40        50        60          ----:----|----:----|----:----|----:----|----:----|----:----|          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca                 / /    / /             /             / /  ///                 | TaqI | HinP1I        AciI          | |  ||BssKI                 Bsc4I  | Hin6I                       | |  |BsiSI                 BsiYI  | HspAI                       | |  |HpaII                        HhaI                          | |  Ksp632I                                                      | |  Bsu6I                                                      | HinP1I                                                      | Hin6I                                                      | HspAI                                                      HhaI# Enzymes that cut  Frequency      AciI          1     Bsc4I          1     BsiSI          1     BsiYI          1     BssKI          1     Bsu6I          1      HhaI          2     Hin6I          2    HinP1I          2     HpaII          1     HspAI          2   Ksp632I          1      TaqI          1# Enzymes which cut less frequently than the MINCUTS criterion# Enzymes < MINCUTS Frequency# Enzymes which cut more frequently than the MAXCUTS criterion# Enzymes > MAXCUTS Frequency# Enzymes that do not cutAclI      BamHI     BceAI     Bse1I     BseYI     BshI      BsrI      ClaIEcoRI     EcoRII    HaeIII    Hin4I     HindII    HindIII   HpyCH4IV  KpnIMaeII     NotI# No. of cutting enzymes which do not match the# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria0  Output files for usage example 4  File: eclac.remapECLACE.coli lactose operon with lacI, lacZ, lacY and lacA genes.                                                                  Ksp632I                                                        >.........====                                                          HpaII                                                          >===                        HhaI                             BssKI                        ==>=                            >=====                 TaqI   Hin6I                         HhaI                 >===   >===                          ==>=              BsiYI                      AciI         Hin6I              ======>====             >..====         >===          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt                   10        20        30        40        50        60          ----:----|----:----|----:----|----:----|----:----|----:----|          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca              ====<======                <===         ===<              BsiYI                      AciI         Hin6I                 ===<   ===<                          =<==  <.....====                 TaqI   Hin6I                         HhaI        Ksp632I                        =<==                             =====<                        HhaI                             BssKI                                                          ===<                                                          HpaII# Enzymes that cut  Frequency   Isoschizomers      AciI          1     BsiYI          1   Bsc4I     BssKI          1      HhaI          2     Hin6I          2   HinP1I,HspAI     HpaII          1   BsiSI   Ksp632I          1   Bsu6I      TaqI          1# Enzymes which cut less frequently than the MINCUTS criterion# Enzymes < MINCUTS Frequency   Isoschizomers# Enzymes which cut more frequently than the MAXCUTS criterion# Enzymes > MAXCUTS Frequency   Isoschizomers# Enzymes that do not cutAclI      BamHI     BceAI     BseYI     BsrI      ClaI      EcoRI     EcoRIIHaeIII    Hin4I     HindII    HindIII   KpnI      MaeII     NotI# No. of cutting enzymes which do not match the# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria0   The name of the sequence is displayed, followed by the description of   the sequence.   The formatted display of cut sites on the sequence follows, with the   six-frame translation below it. The cut sites are indicated by a slash   character '\' that points to the poition between the nucleotides where   the cuts occur. Cuts by many enzymes at the same position are   indicated by stacking the enzyme names on top of each other.   At the end the section header 'Enzymes that cut' is displayed followed   by a list of the enzymes that cut the specified sequence and the   number of times that they cut. For each enzyme that cuts, a list of   isoschizomers of that enzyme (sharing the same recognition site   pattern and cut sites) is given.   This is followed by lists of the enzymes that do cut, but which cut   less often than the '-mincut' qualifier or more often than the   '-maxcut' qualifier.   Any of the isoschizomers that are excluded from cutting, (either   through restrictions such as the permitted number of cuts, blunt   cutters only, single cutters only etc. or because their name has not   been given in the input list of enzymes), will not be listed.   Then a list is displayed of the enzymes whose names were input and   which match the other criteria ('-sitelen', '-blunt', '-sticky',   '-ambiguity' or '-commercial') but which do not cut.   Finally the number of enzymes that were rejected from consideration   because they do not match the '-sitelen', '-blunt', '-sticky',   '-ambiguity' or '-commercial' criteria is displayed.   The '-flatreformat' qualifier changes the display to emphasise the   recognition site of the restriction enzyme, which is indicated by a   row of '=' characters. The cut site if pointed to by a '>' or '<'   character and if the cut site is not within or imemdiately adjacent to   the recognition site, they are linked by a row of '.' characters.   The name of the enzyme is displayed above (or below when the reverse   sense site if displayed) the recognition site. The name of the enzyme   is also displayed above the cut site if this occurs on a different   display line to the recognition site (i.e. if it wraps onto the next   line of sequence).Data files   EMBOSS data files are distributed with the application and stored in   the standard EMBOSS data directory, which is defined by the EMBOSS   environment variable EMBOSS_DATA.   To see the available EMBOSS data files, run:% embossdata -showall   To fetch one of the data files (for example 'Exxx.dat') into your   current directory for you to inspect or modify, run:% embossdata -fetch -file Exxx.dat   Users can provide their own data files in their own directories.   Project specific files can be put in the current directory, or for   tidier directory listings in a subdirectory called ".embossdata".   Files for all EMBOSS runs can be put in the user's home directory, or   again in a subdirectory called ".embossdata".   The directories are searched in the following order:     * . (your current directory)     * .embossdata (under your current directory)     * ~/ (your home directory)     * ~/.embossdata   The EMBOSS REBASE restriction enzyme data files are stored iin   directory 'data/REBASE/*' under the EMBOSS installation directory.   These files must first be set up using the program 'rebaseextract'.   Running 'rebaseextract' may be the job of your system manager.   The data files are stored in the REBASE directory of the standard   EMBOSS data directory. The names are:     * embossre.enz Cleavage information     * embossre.ref Reference/methylation information     * embossre.sup Supplier information   The column information is described at the top of the data files   The reported enzyme from any one group of isoschizomers (the   prototype) is specified in the REBASE database and the information is   held in the data file 'embossre.equ'. You may edit this file to set   your own preferred prototype, if you wish.   The format of the file "embossre.equ" is   Enzyme-name Prototype-name   i.e. two columns of enzyme names separated by a space. The first name   of the pair of enzymes is the name that is not preferred and the   second is the preferred (prototype) name.Notes   None.References   None.Warnings   None.Diagnostic Error Messages   None.Exit status   It always exits with status 0.Known bugs   None.See also   Program name                         Description   abiview       Reads ABI file and display the trace   backtranambig Back translate a protein sequence to ambiguous codons   backtranseq   Back translate a protein sequence   cirdna        Draws circular maps of DNA constructs   coderet       Extract CDS, mRNA and translations from feature tables   lindna        Draws linear maps of DNA constructs   pepnet        Displays proteins as a helical net   pepwheel      Shows protein sequences as helices   plotorf       Plot potential open reading frames   prettyplot    Displays aligned sequences, with colouring and boxing   prettyseq     Output sequence with translated ranges   recoder       Remove restriction sites but maintain same translation   redata        Search REBASE for enzyme name, references, suppliers etc   restover      Find restriction enzymes producing specific overhang   restrict      Finds restriction enzyme cleavage sites   seealso       Finds programs sharing group names   showalign     Displays a multiple sequence alignment   showdb        Displays information on the currently available databases   showfeat      Show features of a sequence   showorf       Pretty output of DNA translations   showseq       Display a sequence with features, translation etc   silent        Silent mutation restriction enzyme scan   sixpack       Display a DNA sequence with 6-frame translation and ORFs   textsearch    Search sequence documentation. Slow, use SRS and Entrez!   transeq       Translate nucleic acid sequencesAuthor(s)   Gary Williams (gwilliam 

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?