remap.txt

emboss的linux版本的源代码

     HpaII          1   BsiSI
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BseYI     BsrI      ClaI      EcoRI     EcoRII

HaeIII    Hin4I     HindII    HindIII   KpnI      MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

  Output files for usage example 3

  File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      HspAI
                                                      Hin6I
                 TaqI                                 HinP1I
                 |  BsiYI                             | HhaI
                 |  Bsc4I                             | Bsu6I
                 |  |   HspAI                         | BssKI
                 |  |   Hin6I                         | Ksp632I
                 |  |   HinP1I                        | | HpaII
                 |  |   | HhaI        AciI            | | BsiSI
                 \  \   \ \           \               \ \ \
          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
                 / /    / /             /             / /  ///
                 | TaqI | HinP1I        AciI          | |  ||BssKI
                 Bsc4I  | Hin6I                       | |  |BsiSI
                 BsiYI  | HspAI                       | |  |HpaII
                        HhaI                          | |  Ksp632I
                                                      | |  Bsu6I
                                                      | HinP1I
                                                      | Hin6I
                                                      | HspAI
                                                      HhaI


# Enzymes that cut  Frequency
      AciI          1
     Bsc4I          1
     BsiSI          1
     BsiYI          1
     BssKI          1
     Bsu6I          1
      HhaI          2
     Hin6I          2
    HinP1I          2
     HpaII          1
     HspAI          2
   Ksp632I          1
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency



# Enzymes that do not cut

AclI      BamHI     BceAI     Bse1I     BseYI     BshI      BsrI      ClaI

EcoRI     EcoRII    HaeIII    Hin4I     HindII    HindIII   HpyCH4IV  KpnI

MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

  Output files for usage example 4

  File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                                  Ksp632I
                                                        >.........====
                                                          HpaII
                                                          >===
                        HhaI                             BssKI
                        ==>=                            >=====
                 TaqI   Hin6I                         HhaI
                 >===   >===                          ==>=
              BsiYI                      AciI         Hin6I
              ======>====             >..====         >===
          gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
              ====<======                <===         ===<
              BsiYI                      AciI         Hin6I
                 ===<   ===<                          =<==  <.....====
                 TaqI   Hin6I                         HhaI        Ksp632I
                        =<==                             =====<
                        HhaI                             BssKI
                                                          ===<
                                                          HpaII


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BsiYI          1   Bsc4I
     BssKI          1
      HhaI          2
     Hin6I          2   HinP1I,HspAI
     HpaII          1   BsiSI
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BseYI     BsrI      ClaI      EcoRI     EcoRII

HaeIII    Hin4I     HindII    HindIII   KpnI      MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0

   The name of the sequence is displayed, followed by the description of
   the sequence.

   The formatted display of cut sites on the sequence follows, with the
   six-frame translation below it. The cut sites are indicated by a slash
   character '\' that points to the poition between the nucleotides where
   the cuts occur. Cuts by many enzymes at the same position are
   indicated by stacking the enzyme names on top of each other.

   At the end the section header 'Enzymes that cut' is displayed followed
   by a list of the enzymes that cut the specified sequence and the
   number of times that they cut. For each enzyme that cuts, a list of
   isoschizomers of that enzyme (sharing the same recognition site
   pattern and cut sites) is given.

   This is followed by lists of the enzymes that do cut, but which cut
   less often than the '-mincut' qualifier or more often than the
   '-maxcut' qualifier.

   Any of the isoschizomers that are excluded from cutting, (either
   through restrictions such as the permitted number of cuts, blunt
   cutters only, single cutters only etc. or because their name has not
   been given in the input list of enzymes), will not be listed.

   Then a list is displayed of the enzymes whose names were input and
   which match the other criteria ('-sitelen', '-blunt', '-sticky',
   '-ambiguity' or '-commercial') but which do not cut.

   Finally the number of enzymes that were rejected from consideration
   because they do not match the '-sitelen', '-blunt', '-sticky',
   '-ambiguity' or '-commercial' criteria is displayed.

   The '-flatreformat' qualifier changes the display to emphasise the
   recognition site of the restriction enzyme, which is indicated by a
   row of '=' characters. The cut site if pointed to by a '>' or '<'
   character and if the cut site is not within or imemdiately adjacent to
   the recognition site, they are linked by a row of '.' characters.

   The name of the enzyme is displayed above (or below when the reverse
   sense site if displayed) the recognition site. The name of the enzyme
   is also displayed above the cut site if this occurs on a different
   display line to the recognition site (i.e. if it wraps onto the next
   line of sequence).

Data files

   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.

   To see the available EMBOSS data files, run:

% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".

   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata

   The EMBOSS REBASE restriction enzyme data files are stored iin
   directory 'data/REBASE/*' under the EMBOSS installation directory.

   These files must first be set up using the program 'rebaseextract'.
   Running 'rebaseextract' may be the job of your system manager.

   The data files are stored in the REBASE directory of the standard
   EMBOSS data directory. The names are:
     * embossre.enz Cleavage information
     * embossre.ref Reference/methylation information
     * embossre.sup Supplier information

   The column information is described at the top of the data files

   The reported enzyme from any one group of isoschizomers (the
   prototype) is specified in the REBASE database and the information is
   held in the data file 'embossre.equ'. You may edit this file to set
   your own preferred prototype, if you wish.

   The format of the file "embossre.equ" is
   Enzyme-name Prototype-name

   i.e. two columns of enzyme names separated by a space. The first name
   of the pair of enzymes is the name that is not preferred and the
   second is the preferred (prototype) name.

Notes

   None.

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with status 0.

Known bugs

   None.

See also

   Program name                         Description
   abiview       Reads ABI file and display the trace
   backtranambig Back translate a protein sequence to ambiguous codons
   backtranseq   Back translate a protein sequence
   cirdna        Draws circular maps of DNA constructs
   coderet       Extract CDS, mRNA and translations from feature tables
   lindna        Draws linear maps of DNA constructs
   pepnet        Displays proteins as a helical net
   pepwheel      Shows protein sequences as helices
   plotorf       Plot potential open reading frames
   prettyplot    Displays aligned sequences, with colouring and boxing
   prettyseq     Output sequence with translated ranges
   recoder       Remove restriction sites but maintain same translation
   redata        Search REBASE for enzyme name, references, suppliers etc
   restover      Find restriction enzymes producing specific overhang
   restrict      Finds restriction enzyme cleavage sites
   seealso       Finds programs sharing group names
   showalign     Displays a multiple sequence alignment
   showdb        Displays information on the currently available databases
   showfeat      Show features of a sequence
   showorf       Pretty output of DNA translations
   showseq       Display a sequence with features, translation etc
   silent        Silent mutation restriction enzyme scan
   sixpack       Display a DNA sequence with 6-frame translation and ORFs
   textsearch    Search sequence documentation. Slow, use SRS and Entrez!
   transeq       Translate nucleic acid sequences

Author(s)

   Gary Williams (gwilliam