fuzznuc.txt

emboss的linux版本的源代码

   Patterns for fuzznuc are based on the format of pattern used in the
   PROSITE database, with the difference that the terminating dot '.' and
   the hyphens, '-', between the characters are optional.

   The PROSITE pattern definition from the PROSITE documentation (amended
   to refer to nucleic acid sequences, not proteins) follows.
     * The standard IUPAC one-letter codes for the nucleotides are used.
     * The symbol `n' is used for a position where any nucleotide is
       accepted.
     * Ambiguities are indicated by listing the acceptable nucleotides
       for a given position, between square parentheses `[ ]'. For
       example: [ACG] stands for A or C or G.
     * Ambiguities are also indicated by listing between a pair of curly
       brackets `{ }' the nucleotides that are not accepted at a given
       position. For example: {AG} stands for any nucleotides except A
       and G.
     * Each element in a pattern is separated from its neighbor by a `-'.
       (Optional in fuzznuc).
     * Repetition of an element of the pattern can be indicated by
       following that element with a numerical value or a numerical range
       between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4)
       corresponds to N-N or N-N-N or N-N-N-N.
     * When a pattern is restricted to either the 5' or 3' end of a
       sequence, that pattern either starts with a `<' symbol or
       respectively ends with a `>' symbol.
     * A period ends the pattern. (Optional in fuzznuc).
     * All other characters, including spaces are not allowed.

   For example, in the EMBL entry ECLAC you can look for the pattern:

[CG](5)TG{A}N(1,5)C

   This searches for "C or G" 5 times, followed by T and G, then anything
   except A, then any base (1 to 5 times) before a C.

   You can use ambiguity codes for nucleic acid searches but not within
   [] or {} as they expand to bracketed counterparts. For example, "s" is
   expanded to "[GC]" therefore [S] would be expanded to [[GC]] which is
   illegal.

   Note the use of X is reserved for proteins. You must use N for nucleic
   acids to refer to any base.

   The search is case-independent, so 'AAA' matches 'aaa'.

Output file format

   The output is a standard EMBOSS report file.

   The results can be output in one of several styles by using the
   command-line qualifier -rformat xxx, where 'xxx' is replaced by the
   name of the required format. The available format names are: embl,
   genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel,
   feattable, motif, regions, seqtable, simple, srs, table, tagseq

   See: http://emboss.sf.net/docs/themes/ReportFormats.html for further
   information on report formats.

   By default fuzznuc writes a 'seqtable' report file.

  Output files for usage example

  File: hhtetra.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sat 15 Jul 2006 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:hhtetra
#    -pattern AAGCTT
# Report_format: seqtable
# Report_file: hhtetra.fuzznuc
########################################

#=======================================
#
# Sequence: HHTETRA     from: 1   to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# pattern1            0 AAGCTT
#
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
      1       6 pattern1            . aagctt
   1267    1272 pattern1            . aagctt

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 2
#---------------------------------------

  Output files for usage example 2

  File: hhtetra.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sat 15 Jul 2006 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:hhtetra
#    -pattern @../../data/nucseq.pat
# Report_format: seqtable
# Report_file: hhtetra.fuzznuc
########################################

#=======================================
#
# Sequence: HHTETRA     from: 1   to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# targetseq           0 cg(2)c(3)taaccctagc(3)ta
#
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
    429     448 targetseq           . cggccctaaccctagcccta
    491     510 targetseq           . cggccctaaccctagcccta

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 2
#---------------------------------------

  Output files for usage example 3

  File: hhtetra.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sat 15 Jul 2006 12:00:00
# Commandline: fuzznuc
#    -pname test
#    -sequence tembl:hhtetra
#    -pattern @../../data/nucsimple.pat
# Report_format: seqtable
# Report_file: hhtetra.fuzznuc
########################################

#=======================================
#
# Sequence: HHTETRA     from: 1   to: 1272
# HitCount: 13
#
# Pattern_name Mismatch Pattern
# test1               0 cg(2)c(3)taac
# test2               0 cctagc(3)ta
#
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
    429     438 test1               . cggccctaac
    491     500 test1               . cggccctaac
    535     544 test1               . cggccctaac
    605     614 test1               . cggccctaac
    631     640 test1               . cggccctaac
    695     704 test1               . cggccctaac
    721     730 test1               . cggccctaac
    753     762 test1               . cggccctaac
    293     302 test2               . cctagcccta
    439     448 test2               . cctagcccta
    469     478 test2               . cctagcccta
    501     510 test2               . cctagcccta
    801     810 test2               . cctagcccta

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 13
#---------------------------------------

  Output files for usage example 4

  File: hhtetra.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sat 15 Jul 2006 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:hhtetra
#    -pattern @../../data/nuc.pat
# Report_format: seqtable
# Report_file: hhtetra.fuzznuc
########################################

#=======================================
#
# Sequence: HHTETRA     from: 1   to: 1272
# HitCount: 19
#
# Pattern_name Mismatch Pattern
# pat1                0 cggccctaaccctagcccta
# pat2                1 cg(2)c(3)taaccctagc(3)ta
# pat3                0 cggc(2,4)taac(2,5)
#
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
    429     448 pat1                . cggccctaaccctagcccta
    491     510 pat1                . cggccctaaccctagcccta
    429     448 pat2                . cggccctaaccctagcccta
    491     510 pat2                . cggccctaaccctagcccta
    535     554 pat2                1 cggccctaaccctaacccta
    605     624 pat2                1 cggccctaaccctaacccta
    631     650 pat2                1 cggccctaaccctaacccta
    695     714 pat2                1 cggccctaaccctaacccta
    721     740 pat2                1 cggccctaaccctaacccta
    753     772 pat2                1 cggccctaaccctaacccta
    791     810 pat2                1 cggcccgaaccctagcccta
    429     440 pat3                . cggccctaaccc
    491     502 pat3                . cggccctaaccc
    535     546 pat3                . cggccctaaccc
    605     616 pat3                . cggccctaaccc
    631     642 pat3                . cggccctaaccc
    695     706 pat3                . cggccctaaccc
    721     732 pat3                . cggccctaaccc
    753     764 pat3                . cggccctaaccc

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 19
#---------------------------------------

Data files

   None.

Notes

   None.

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with a status of 0.

Known bugs

   None.

See also

   Program name                    Description
   dreg         Regular expression search of a nucleotide sequence
   fuzztran     Protein pattern search after translation
   marscan      Finds MAR/SAR sites in nucleic sequences

   Other EMBOSS programs allow you to search for regular expression
   patterns but may be less easy for the user who has never used regular
   expressions before:

     * dreg - Regular expression search of a nucleotide sequence
     * preg - Regular expression search of a protein sequence

Author(s)

   Alan Bleasby (ajb