fuzznuc.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 578 行 · 第 1/2 页

TXT
578
字号
                                  fuzznuc Function   Nucleic acid pattern searchDescription   fuzznuc uses PROSITE style patterns to search nucleotide sequences.   Patterns are specifications of a (typically short) length of sequence   to be found. They can specify a search for an exact sequence or they   can allow various ambiguities, matches to variable lengths of sequence   and repeated subsections of the sequence.   fuzznuc intelligently selects the optimum searching algorithm to use,   depending on the complexity of the search pattern specified.Usage   Here is a sample session with fuzznuc% fuzznuc Nucleic acid pattern searchInput nucleotide sequence(s): tembl:hhtetraSearch pattern: AAGCTTOutput report [hhtetra.fuzznuc]:    Go to the input files for this example   Go to the output files for this example   Example 2% fuzznuc Nucleic acid pattern searchInput nucleotide sequence(s): tembl:hhtetraSearch pattern: @nucseq.patOutput report [hhtetra.fuzznuc]:    Go to the input files for this example   Go to the output files for this example   Example 3% fuzznuc -pname test Nucleic acid pattern searchInput nucleotide sequence(s): tembl:hhtetraSearch pattern: @nucsimple.patOutput report [hhtetra.fuzznuc]:    Go to the input files for this example   Go to the output files for this example   Example 4% fuzznuc Nucleic acid pattern searchInput nucleotide sequence(s): tembl:hhtetraSearch pattern: @nuc.patOutput report [hhtetra.fuzznuc]:    Go to the input files for this example   Go to the output files for this exampleCommand line arguments   Standard (Mandatory) qualifiers:  [-sequence]          seqall     Nucleotide sequence(s) filename and optional                                  format, or reference (input USA)   -pattern            pattern    The standard IUPAC one-letter codes for the                                  nucleotides are used.                                  The symbol 'n' is used for a position where                                  any nucleotide is accepted.                                  Ambiguities are indicated by listing the                                  acceptable nucleotides for a given position,                                  between square parentheses '[ ]'. For                                  example: [ACG] stands for A or C or G.                                  Ambiguities are also indicated by listing                                  between a pair of curly brackets '{ }' the                                  nucleotides that are not accepted at a given                                  position. For example: {AG} stands for any                                  nucleotides except A and G.                                  Each element in a pattern is separated from                                  its neighbor by a '-'. (Optional in                                  fuzznuc).                                  Repetition of an element of the pattern can                                  be indicated by following that element with                                  a numerical value or a numerical range                                  between parenthesis. Examples: N(3)                                  corresponds to N-N-N, N(2,4) corresponds to                                  N-N or N-N-N or N-N-N-N.                                  When a pattern is restricted to either the                                  5' or 3' end of a sequence, that pattern                                  either starts with a '<' symbol or                                  respectively ends with a '>' symbol.                                  A period ends the pattern. (Optional in                                  fuzznuc).                                  For example, [CG](5)TG{A}N(1,5)C  [-outfile]           report     [*.fuzznuc] Output report file name   Additional (Optional) qualifiers: (none)   Advanced (Unprompted) qualifiers:   -complement         boolean    [0] Search complementary strand   Associated qualifiers:   "-sequence" associated qualifiers   -sbegin1            integer    Start of each sequence to be used   -send1              integer    End of each sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-pattern" associated qualifiers   -pformat            string     File format   -pmismatch          integer    Pattern mismatch   -pname              string     Pattern base name   "-outfile" associated qualifiers   -rformat2           string     Report format   -rname2             string     Base file name   -rextension2        string     File name extension   -rdirectory2        string     Output directory   -raccshow2          boolean    Show accession number in the report   -rdesshow2          boolean    Show description in the report   -rscoreshow2        boolean    Show the score in the report   -rusashow2          boolean    Show the full USA in the report   -rmaxall2           integer    Maximum total hits to report   -rmaxseq2           integer    Maximum hits to report for one sequence   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format   fuzznuc reads in normal nucleic acid sequence USAs.  Input files for usage example   'tembl:hhtetra' is a sequence entry in the example nucleic acid   database 'tembl'  Database entry: tembl:hhtetraID   HHTETRA    standard; DNA; VRL; 1272 BP.XXAC   L46634; L46689;XXSV   L46634.1XXDT   06-NOV-1995 (Rel. 45, Created)DT   04-MAR-2000 (Rel. 63, Last updated, Version 3)XXDE   Human herpesvirus 7 (clone ED132'1.2) telomeric repeat region.XXKW   telomeric repeat.XXOS   Human herpesvirus 7OC   Viruses; dsDNA viruses, no RNA stage; Herpesviridae; Betaherpesvirinae.XXRN   [1]RP   1-1272RX   MEDLINE; 96079055.RA   Secchiero P., Nicholas J., Deng H., Xiaopeng T., van Loon N., Ruvolo V.R.,RA   Berneman Z.N., Reitz M.S. Jr., Dewhurst S.;RT   "Identification of human telomeric repeat motifs at the genome termini ofRT   human herpesvirus 7: structural analysis and heterogeneity";RL   J. Virol. 69(12):8041-8045(1995).XXFH   Key             Location/QualifiersFHFT   source          1..1272FT                   /db_xref="taxon:10372"FT                   /organism="Human herpesvirus 7"FT                   /strain="JI"FT                   /clone="ED132'1.2"FT   repeat_region   207..928FT                   /note="long and complex repeat region composed of variousFT                   direct repeats, including TAACCC (TRS), degenerate copiesFT                   of TRS motifs and a 14-bp repeat, TAGGGCTGCGGCCC"FT   misc_signal     938..998FT                   /note="pac2 motif"FT   misc_feature    1009FT                   /note="right genome terminus (...ACA)"XXSQ   Sequence 1272 BP; 346 A; 455 C; 222 G; 249 T; 0 other;     aagcttaaac tgaggtcaca cacgacttta attacggcaa cgcaacagct gtaagctgca        60     ggaaagatac gatcgtaagc aaatgtagtc ctacaatcaa gcgaggttgt agacgttacc       120     tacaatgaac tacacctcta agcataacct gtcgggcaca gtgagacacg cagccgtaaa       180     ttcaaaactc aacccaaacc gaagtctaag tctcacccta atcgtaacag taaccctaca       240     actctaatcc tagtccgtaa ccgtaacccc aatcctagcc cttagcccta accctagccc       300     taaccctagc tctaacctta gctctaactc tgaccctagg cctaacccta agcctaaccc       360     taaccgtagc tctaagttta accctaaccc taaccctaac catgaccctg accctaaccc       420     tagggctgcg gccctaaccc tagccctaac cctaacccta atcctaatcc tagccctaac       480     cctagggctg cggccctaac cctagcccta accctaaccc taaccctagg gctgcggccc       540     taaccctaac cctagggctg cggcccgaac cctaacccta accctaaccc taaccctagg       600     gctgcggccc taaccctaac cctagggctg cggccctaac cctaacccta gggctgcggc       660     ccgaacccta accctaaccc taaccctagg gctgcggccc taaccctaac cctagggctg       720     cggccctaac cctaacccta actctagggc tgcggcccta accctaaccc taaccctaac       780     cctagggctg cggcccgaac cctagcccta accctaaccc tgaccctgac cctaacccta       840     accctaaccc taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta       900     accctaaccc taaccctaac cctaaccccg cccccactgg cagccaatgt cttgtaatgc       960     cttcaaggca ctttttctgc gagccgcgcg cagcactcag tgaaaaacaa gtttgtgcac      1020     gagaaagacg ctgccaaacc gcagctgcag catgaaggct gagtgcacaa ttttggcttt      1080     agtcccataa aggcgcggct tcccgtagag tagaaaaccg cagcgcggcg cacagagcga      1140     aggcagcggc tttcagactg tttgccaagc gcagtctgca tcttaccaat gatgatcgca      1200     agcaagaaaa atgttctttc ttagcatatg cgtggttaat cctgttgtgg tcatcactaa      1260     gttttcaagc tt                                                          1272//  Input files for usage example 2  File: nucseq.pat>targetseqcg(2)c(3)taaccctagc(3)ta  Input files for usage example 3  File: nucsimple.patcg(2)c(3)taaccctagc(3)ta  Input files for usage example 4  File: nuc.pat>pat1cggccctaaccctagcccta>pat2 <mismatch=1>cg(2)c(3)taaccctagc(3)ta>pat3cggc(2,4)taac(2,5)  Pattern specification

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?