fuzznuc.txt

emboss的linux版本的源代码

                                  fuzznuc 



Function

   Nucleic acid pattern search

Description

   fuzznuc uses PROSITE style patterns to search nucleotide sequences.

   Patterns are specifications of a (typically short) length of sequence
   to be found. They can specify a search for an exact sequence or they
   can allow various ambiguities, matches to variable lengths of sequence
   and repeated subsections of the sequence.

   fuzznuc intelligently selects the optimum searching algorithm to use,
   depending on the complexity of the search pattern specified.

Usage

   Here is a sample session with fuzznuc


% fuzznuc 
Nucleic acid pattern search
Input nucleotide sequence(s): tembl:hhtetra
Search pattern: AAGCTT
Output report [hhtetra.fuzznuc]: 

   Go to the input files for this example
   Go to the output files for this example

   Example 2


% fuzznuc 
Nucleic acid pattern search
Input nucleotide sequence(s): tembl:hhtetra
Search pattern: @nucseq.pat
Output report [hhtetra.fuzznuc]: 

   Go to the input files for this example
   Go to the output files for this example

   Example 3


% fuzznuc -pname test 
Nucleic acid pattern search
Input nucleotide sequence(s): tembl:hhtetra
Search pattern: @nucsimple.pat
Output report [hhtetra.fuzznuc]: 

   Go to the input files for this example
   Go to the output files for this example

   Example 4


% fuzznuc 
Nucleic acid pattern search
Input nucleotide sequence(s): tembl:hhtetra
Search pattern: @nuc.pat
Output report [hhtetra.fuzznuc]: 

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -pattern            pattern    The standard IUPAC one-letter codes for the
                                  nucleotides are used.
                                  The symbol 'n' is used for a position where
                                  any nucleotide is accepted.
                                  Ambiguities are indicated by listing the
                                  acceptable nucleotides for a given position,
                                  between square parentheses '[ ]'. For
                                  example: [ACG] stands for A or C or G.
                                  Ambiguities are also indicated by listing
                                  between a pair of curly brackets '{ }' the
                                  nucleotides that are not accepted at a given
                                  position. For example: {AG} stands for any
                                  nucleotides except A and G.
                                  Each element in a pattern is separated from
                                  its neighbor by a '-'. (Optional in
                                  fuzznuc).
                                  Repetition of an element of the pattern can
                                  be indicated by following that element with
                                  a numerical value or a numerical range
                                  between parenthesis. Examples: N(3)
                                  corresponds to N-N-N, N(2,4) corresponds to
                                  N-N or N-N-N or N-N-N-N.
                                  When a pattern is restricted to either the
                                  5' or 3' end of a sequence, that pattern
                                  either starts with a '<' symbol or
                                  respectively ends with a '>' symbol.
                                  A period ends the pattern. (Optional in
                                  fuzznuc).
                                  For example, [CG](5)TG{A}N(1,5)C
  [-outfile]           report     [*.fuzznuc] Output report file name

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -complement         boolean    [0] Search complementary strand

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-pattern" associated qualifiers
   -pformat            string     File format
   -pmismatch          integer    Pattern mismatch
   -pname              string     Pattern base name

   "-outfile" associated qualifiers
   -rformat2           string     Report format
   -rname2             string     Base file name
   -rextension2        string     File name extension
   -rdirectory2        string     Output directory
   -raccshow2          boolean    Show accession number in the report
   -rdesshow2          boolean    Show description in the report
   -rscoreshow2        boolean    Show the score in the report
   -rusashow2          boolean    Show the full USA in the report
   -rmaxall2           integer    Maximum total hits to report
   -rmaxseq2           integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   fuzznuc reads in normal nucleic acid sequence USAs.

  Input files for usage example

   'tembl:hhtetra' is a sequence entry in the example nucleic acid
   database 'tembl'

  Database entry: tembl:hhtetra

ID   HHTETRA    standard; DNA; VRL; 1272 BP.
XX
AC   L46634; L46689;
XX
SV   L46634.1
XX
DT   06-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 3)
XX
DE   Human herpesvirus 7 (clone ED132'1.2) telomeric repeat region.
XX
KW   telomeric repeat.
XX
OS   Human herpesvirus 7
OC   Viruses; dsDNA viruses, no RNA stage; Herpesviridae; Betaherpesvirinae.
XX
RN   [1]
RP   1-1272
RX   MEDLINE; 96079055.
RA   Secchiero P., Nicholas J., Deng H., Xiaopeng T., van Loon N., Ruvolo V.R.,
RA   Berneman Z.N., Reitz M.S. Jr., Dewhurst S.;
RT   "Identification of human telomeric repeat motifs at the genome termini of
RT   human herpesvirus 7: structural analysis and heterogeneity";
RL   J. Virol. 69(12):8041-8045(1995).
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..1272
FT                   /db_xref="taxon:10372"
FT                   /organism="Human herpesvirus 7"
FT                   /strain="JI"
FT                   /clone="ED132'1.2"
FT   repeat_region   207..928
FT                   /note="long and complex repeat region composed of various
FT                   direct repeats, including TAACCC (TRS), degenerate copies
FT                   of TRS motifs and a 14-bp repeat, TAGGGCTGCGGCCC"
FT   misc_signal     938..998
FT                   /note="pac2 motif"
FT   misc_feature    1009
FT                   /note="right genome terminus (...ACA)"
XX
SQ   Sequence 1272 BP; 346 A; 455 C; 222 G; 249 T; 0 other;
     aagcttaaac tgaggtcaca cacgacttta attacggcaa cgcaacagct gtaagctgca        6
0
     ggaaagatac gatcgtaagc aaatgtagtc ctacaatcaa gcgaggttgt agacgttacc       12
0
     tacaatgaac tacacctcta agcataacct gtcgggcaca gtgagacacg cagccgtaaa       18
0
     ttcaaaactc aacccaaacc gaagtctaag tctcacccta atcgtaacag taaccctaca       24
0
     actctaatcc tagtccgtaa ccgtaacccc aatcctagcc cttagcccta accctagccc       30
0
     taaccctagc tctaacctta gctctaactc tgaccctagg cctaacccta agcctaaccc       36
0
     taaccgtagc tctaagttta accctaaccc taaccctaac catgaccctg accctaaccc       42
0
     tagggctgcg gccctaaccc tagccctaac cctaacccta atcctaatcc tagccctaac       48
0
     cctagggctg cggccctaac cctagcccta accctaaccc taaccctagg gctgcggccc       54
0
     taaccctaac cctagggctg cggcccgaac cctaacccta accctaaccc taaccctagg       60
0
     gctgcggccc taaccctaac cctagggctg cggccctaac cctaacccta gggctgcggc       66
0
     ccgaacccta accctaaccc taaccctagg gctgcggccc taaccctaac cctagggctg       72
0
     cggccctaac cctaacccta actctagggc tgcggcccta accctaaccc taaccctaac       78
0
     cctagggctg cggcccgaac cctagcccta accctaaccc tgaccctgac cctaacccta       84
0
     accctaaccc taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta       90
0
     accctaaccc taaccctaac cctaaccccg cccccactgg cagccaatgt cttgtaatgc       96
0
     cttcaaggca ctttttctgc gagccgcgcg cagcactcag tgaaaaacaa gtttgtgcac      102
0
     gagaaagacg ctgccaaacc gcagctgcag catgaaggct gagtgcacaa ttttggcttt      108
0
     agtcccataa aggcgcggct tcccgtagag tagaaaaccg cagcgcggcg cacagagcga      114
0
     aggcagcggc tttcagactg tttgccaagc gcagtctgca tcttaccaat gatgatcgca      120
0
     agcaagaaaa atgttctttc ttagcatatg cgtggttaat cctgttgtgg tcatcactaa      126
0
     gttttcaagc tt                                                          127
2
//

  Input files for usage example 2

  File: nucseq.pat

>targetseq
cg(2)c(3)taac
cctagc(3)ta

  Input files for usage example 3

  File: nucsimple.pat

cg(2)c(3)taac
cctagc(3)ta

  Input files for usage example 4

  File: nuc.pat

>pat1
cggccctaaccctagcccta
>pat2 <mismatch=1>
cg(2)c(3)taac
cctagc(3)ta
>pat3
cggc(2,4)taac(2,5)

  Pattern specification