sixpack.txt

emboss的linux版本的源代码

                                  sixpack 



Function

   Display a DNA sequence with 6-frame translation and ORFs

Description

   sixpack takes a nucleic acid sequence and writes out the forward and
   reverse senses of the sequence with the 3 forward and three reverse
   translations in a pretty display format.

   It also writes a file containing the open reading frames that are
   larger than the specified minimum size (default 1 base, showing all
   possible open reading frames). These open reading frames are written
   as protein sequences in the default output sequence format.

   An open reading frame is defined in this program as any possible
   translation between two STOP codons.

Algorithm

   The nucleic acid sequence is read in.
   The required genetic code is read in from the EGC* data files.
   The three forward and three reverse translations are created.
   The name and description are written to the ouput display file.
   Any required regions to be changed to upper case are changed.
   Any required regions to be highlighted in HTML colour tags are
   changed.
   The reverse sense sequence is placed below the forward sequence.
   The forward translations are placed above the sequences.
   The reverse translation are placed below the sequences.
   The display is written out, split at the ends of lines.
   Any ORFs that are longer than the specified minimum size are written
   to the output sequence file.

Usage

   Here is a sample session with sixpack


% sixpack 
Display a DNA sequence with 6-frame translation and ORFs
Input nucleotide sequence: tembl:paamir
Output file [paamir.sixpack]: 
protein output sequence(s) [paamir.fasta]: 

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.sixpack] Output file name
   -outseq             seqoutall  [.] ORF sequence output

   Additional (Optional) qualifiers:
   -table              menu       [0] Genetics code used for the translation
                                  (Values: 0 (Standard); 1 (Standard (with
                                  alternative initiation codons)); 2
                                  (Vertebrate Mitochondrial); 3 (Yeast
                                  Mitochondrial); 4 (Mold, Protozoan,
                                  Coelenterate Mitochondrial and
                                  Mycoplasma/Spiroplasma); 5 (Invertebrate
                                  Mitochondrial); 6 (Ciliate Macronuclear and
                                  Dasycladacean); 9 (Echinoderm
                                  Mitochondrial); 10 (Euplotid Nuclear); 11
                                  (Bacterial); 12 (Alternative Yeast Nuclear);
                                  13 (Ascidian Mitochondrial); 14 (Flatworm
                                  Mitochondrial); 15 (Blepharisma
                                  Macronuclear); 16 (Chlorophycean
                                  Mitochondrial); 21 (Trematode
                                  Mitochondrial); 22 (Scenedesmus obliquus);
                                  23 (Thraustochytrium Mitochondrial))
   -[no]firstorf       boolean    [Y] Count the beginning of a sequence as a
                                  possible ORF, even if it's inferior to the
                                  minimal ORF size.
   -[no]lastorf        boolean    [Y] Count the end of a sequence as a
                                  possible ORF, even if it's not finishing
                                  with a STOP, or inferior to the minimal ORF
                                  size.
   -mstart             boolean    [N] Displays only ORFs starting with an M.

   Advanced (Unprompted) qualifiers:
   -[no]reverse        boolean    [Y] Display also the translation of the DNA
                                  sequence in the 3 reverse frames
   -orfminsize         integer    [1] Minimum size of Open Reading Frames
                                  (ORFs) to display in the translations.
                                  (Integer 1 or more)
   -uppercase          range      [If this is left blank, then the sequence
                                  case is left alone.] Regions to put in
                                  uppercase.
                                  If this is left blank, then the sequence
                                  case is left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
   -highlight          range      [(full sequence)] Regions to colour if
                                  formatting for HTML.
                                  If this is left blank, then the sequence is
                                  left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are followed by any valid HTML font
                                  colour.
                                  Examples of region specifications are:
                                  24-45 blue 56-78 orange
                                  1-100 green 120-156 red
                                  A file of ranges to colour (one range per
                                  line) can be specifed as '@filename'.
   -[no]number         boolean    [Y] Number the sequence at the beginning and
                                  the end of each line.
   -width              integer    [60] Number of nucleotides displayed on each
                                  line (Integer 1 or more)
   -length             integer    [0] Line length of page (0 for indefinite)
                                  (Integer 0 or more)
   -margin             integer    [10] Margin around sequence for numbering.
                                  (Integer 0 or more)
   -[no]name           boolean    [Y] Set this to be false if you do not wish
                                  to display the ID name of the sequence.
   -[no]description    boolean    [Y] Set this to be false if you do not wish
                                  to display the description of the sequence.
   -offset             integer    [1] Number from which you want the DNA
                                  sequence to be numbered. (Any integer value)
   -html               boolean    [N] Use HTML formatting

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-outseq" associated qualifiers
   -osformat           string     Output seq format
   -osextension        string     File name extension
   -osname             string     Base file name
   -osdirectory        string     Output directory
   -osdbname           string     Database name to add
   -ossingle           boolean    Separate file for each entry
   -oufo               string     UFO features
   -offormat           string     Features format
   -ofname             string     Features file name
   -ofdirectory        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   sixpack reads any normal sequence USAs.

  Input files for usage example

   'tembl:paamir' is a sequence entry in the example nucleic acid
   database 'tembl'

  Database entry: tembl:paamir

ID   PAAMIR     standard; DNA; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
SV   X13776.1
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   17-FEB-1997 (Rel. 50, Last updated, Version 22)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas
.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
RN   [2]
RP   1167-2167
RX   MEDLINE; 89211409.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomona
s
RT   aeruginosa";
RL   FEBS Lett. 246:39-43(1989).
XX
RN   [3]
RP   1-1292
RX   MEDLINE; 91317707.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173:4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
DR   SWISS-PROT; P10932; AMIR_PSEAE.
DR   SWISS-PROT; P27017; AMIC_PSEAE.
DR   SWISS-PROT; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   phenotype"
FT                   /replace=""
FT                   /gene="amiC"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 cause
s
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        6
0
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       12
0
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       18
0
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       24
0
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       30
0
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       36
0
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       42
0
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       48
0
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       54
0
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       60
0
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       66
0
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       72
0
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       78
0
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       84
0
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       90
0
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       96
0
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      102
0
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      108
0
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      114
0
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      120
0
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      126
0
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      132
0
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      138
0
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      144
0
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      150
0
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      156
0
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      162
0
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      168
0
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      174
0
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      180
0
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      186
0
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      192
0
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      198
0
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      204
0
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      210
0
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      216
0
     cctcgag                                                                216
7
//

Output file format

  Output files for usage example

  File: paamir.sixpack

PAAMIR
Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase
regulation


          G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  L  H  D     F1
           V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N  C  T  I    F2
            Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G  T  A  R  S   F3
        1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat 60
          ----:----|----:----|----:----|----:----|----:----|----:----|
        1 ccatggcgaccggctcgtagacgagctagtggtggtcggcccgctgcccttgacgtgcta 60
           P  V  A  P  R  A  D  A  R  D  G  G  A  P  R  R  S  S  C  S    F6
          X  Y  R  Q  G  L  M  Q  E  I  V  V  L  R  A  V  P  V  A  R     F5
            T  G  S  A  S  C  R  S  S  *  W  W  G  P  S  P  F  Q  V  I   F4


          L  P  G  E  P  G  A  R  A  G  S  L  R  T  A  L  S  D  S  H     F1
           Y  L  A  S  L  E  H  E  R  V  R  F  V  R  R  *  A  T  V  T    F2
            T  W  R  A  W  S  T  S  G  F  A  S  Y  G  A  E  R  Q  S  Q   F3