sixpack.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 740 行 · 第 1/2 页

TXT
740
字号
                                  sixpack Function   Display a DNA sequence with 6-frame translation and ORFsDescription   sixpack takes a nucleic acid sequence and writes out the forward and   reverse senses of the sequence with the 3 forward and three reverse   translations in a pretty display format.   It also writes a file containing the open reading frames that are   larger than the specified minimum size (default 1 base, showing all   possible open reading frames). These open reading frames are written   as protein sequences in the default output sequence format.   An open reading frame is defined in this program as any possible   translation between two STOP codons.Algorithm   The nucleic acid sequence is read in.   The required genetic code is read in from the EGC* data files.   The three forward and three reverse translations are created.   The name and description are written to the ouput display file.   Any required regions to be changed to upper case are changed.   Any required regions to be highlighted in HTML colour tags are   changed.   The reverse sense sequence is placed below the forward sequence.   The forward translations are placed above the sequences.   The reverse translation are placed below the sequences.   The display is written out, split at the ends of lines.   Any ORFs that are longer than the specified minimum size are written   to the output sequence file.Usage   Here is a sample session with sixpack% sixpack Display a DNA sequence with 6-frame translation and ORFsInput nucleotide sequence: tembl:paamirOutput file [paamir.sixpack]: protein output sequence(s) [paamir.fasta]:    Go to the input files for this example   Go to the output files for this exampleCommand line arguments   Standard (Mandatory) qualifiers:  [-sequence]          sequence   Nucleotide sequence filename and optional                                  format, or reference (input USA)  [-outfile]           outfile    [*.sixpack] Output file name   -outseq             seqoutall  [.] ORF sequence output   Additional (Optional) qualifiers:   -table              menu       [0] Genetics code used for the translation                                  (Values: 0 (Standard); 1 (Standard (with                                  alternative initiation codons)); 2                                  (Vertebrate Mitochondrial); 3 (Yeast                                  Mitochondrial); 4 (Mold, Protozoan,                                  Coelenterate Mitochondrial and                                  Mycoplasma/Spiroplasma); 5 (Invertebrate                                  Mitochondrial); 6 (Ciliate Macronuclear and                                  Dasycladacean); 9 (Echinoderm                                  Mitochondrial); 10 (Euplotid Nuclear); 11                                  (Bacterial); 12 (Alternative Yeast Nuclear);                                  13 (Ascidian Mitochondrial); 14 (Flatworm                                  Mitochondrial); 15 (Blepharisma                                  Macronuclear); 16 (Chlorophycean                                  Mitochondrial); 21 (Trematode                                  Mitochondrial); 22 (Scenedesmus obliquus);                                  23 (Thraustochytrium Mitochondrial))   -[no]firstorf       boolean    [Y] Count the beginning of a sequence as a                                  possible ORF, even if it's inferior to the                                  minimal ORF size.   -[no]lastorf        boolean    [Y] Count the end of a sequence as a                                  possible ORF, even if it's not finishing                                  with a STOP, or inferior to the minimal ORF                                  size.   -mstart             boolean    [N] Displays only ORFs starting with an M.   Advanced (Unprompted) qualifiers:   -[no]reverse        boolean    [Y] Display also the translation of the DNA                                  sequence in the 3 reverse frames   -orfminsize         integer    [1] Minimum size of Open Reading Frames                                  (ORFs) to display in the translations.                                  (Integer 1 or more)   -uppercase          range      [If this is left blank, then the sequence                                  case is left alone.] Regions to put in                                  uppercase.                                  If this is left blank, then the sequence                                  case is left alone.                                  A set of regions is specified by a set of                                  pairs of positions.                                  The positions are integers.                                  They are separated by any non-digit,                                  non-alpha character.                                  Examples of region specifications are:                                  24-45, 56-78                                  1:45, 67=99;765..888                                  1,5,8,10,23,45,57,99   -highlight          range      [(full sequence)] Regions to colour if                                  formatting for HTML.                                  If this is left blank, then the sequence is                                  left alone.                                  A set of regions is specified by a set of                                  pairs of positions.                                  The positions are integers.                                  They are followed by any valid HTML font                                  colour.                                  Examples of region specifications are:                                  24-45 blue 56-78 orange                                  1-100 green 120-156 red                                  A file of ranges to colour (one range per                                  line) can be specifed as '@filename'.   -[no]number         boolean    [Y] Number the sequence at the beginning and                                  the end of each line.   -width              integer    [60] Number of nucleotides displayed on each                                  line (Integer 1 or more)   -length             integer    [0] Line length of page (0 for indefinite)                                  (Integer 0 or more)   -margin             integer    [10] Margin around sequence for numbering.                                  (Integer 0 or more)   -[no]name           boolean    [Y] Set this to be false if you do not wish                                  to display the ID name of the sequence.   -[no]description    boolean    [Y] Set this to be false if you do not wish                                  to display the description of the sequence.   -offset             integer    [1] Number from which you want the DNA                                  sequence to be numbered. (Any integer value)   -html               boolean    [N] Use HTML formatting   Associated qualifiers:   "-sequence" associated qualifiers   -sbegin1            integer    Start of the sequence to be used   -send1              integer    End of the sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-outfile" associated qualifiers   -odirectory2        string     Output directory   "-outseq" associated qualifiers   -osformat           string     Output seq format   -osextension        string     File name extension   -osname             string     Base file name   -osdirectory        string     Output directory   -osdbname           string     Database name to add   -ossingle           boolean    Separate file for each entry   -oufo               string     UFO features   -offormat           string     Features format   -ofname             string     Features file name   -ofdirectory        string     Output directory   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format   sixpack reads any normal sequence USAs.  Input files for usage example   'tembl:paamir' is a sequence entry in the example nucleic acid   database 'tembl'  Database entry: tembl:paamirID   PAAMIR     standard; DNA; PRO; 2167 BP.XXAC   X13776; M43175;XXSV   X13776.1XXDT   19-APR-1989 (Rel. 19, Created)DT   17-FEB-1997 (Rel. 50, Last updated, Version 22)XXDE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulationXXKW   aliphatic amidase regulator; amiC gene; amiR gene.XXOS   Pseudomonas aeruginosaOC   Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas.XXRN   [1]RP   1167-2167RA   Rice P.M.;RT   ;RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.XXRN   [2]RP   1167-2167RX   MEDLINE; 89211409.RA   Lowe N., Rice P.M., Drew R.E.;RT   "Nucleotide sequence of the aliphatic amidase regulator gene of PseudomonasRT   aeruginosa";RL   FEBS Lett. 246:39-43(1989).XXRN   [3]RP   1-1292RX   MEDLINE; 91317707.RA   Wilson S., Drew R.;RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of theRT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiCRT   product.";RL   J. Bacteriol. 173:4914-4921(1991).XXRN   [4]RP   1-2167RA   Rice P.M.;RT   ;RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.XXDR   SWISS-PROT; P10932; AMIR_PSEAE.DR   SWISS-PROT; P27017; AMIC_PSEAE.DR   SWISS-PROT; Q51417; AMIS_PSEAE.  [Part of this file has been deleted for brevity]FT                   phenotype"FT                   /replace=""FT                   /gene="amiC"FT   misc_feature    1FT                   /note="last base of an XhoI site"FT   misc_feature    648..653FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causesFT                   constitutive expression of amiE"FT   conflict        1281FT                   /replace="g"FT                   /citation=[3]XXSQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160     cctcgag                                                                2167//Output file format  Output files for usage example  File: paamir.sixpackPAAMIRPseudomonas aeruginosa amiC and amiR gene for aliphatic amidaseregulation          G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  L  H  D     F1           V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N  C  T  I    F2            Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G  T  A  R  S   F3        1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat 60          ----:----|----:----|----:----|----:----|----:----|----:----|        1 ccatggcgaccggctcgtagacgagctagtggtggtcggcccgctgcccttgacgtgcta 60           P  V  A  P  R  A  D  A  R  D  G  G  A  P  R  R  S  S  C  S    F6          X  Y  R  Q  G  L  M  Q  E  I  V  V  L  R  A  V  P  V  A  R     F5            T  G  S  A  S  C  R  S  S  *  W  W  G  P  S  P  F  Q  V  I   F4          L  P  G  E  P  G  A  R  A  G  S  L  R  T  A  L  S  D  S  H     F1           Y  L  A  S  L  E  H  E  R  V  R  F  V  R  R  *  A  T  V  T    F2            T  W  R  A  W  S  T  S  G  F  A  S  Y  G  A  E  R  Q  S  Q   F3

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?