sixpack.txt
来自「emboss的linux版本的源代码」· 文本 代码 · 共 740 行 · 第 1/2 页
TXT
740 行
sixpack Function Display a DNA sequence with 6-frame translation and ORFsDescription sixpack takes a nucleic acid sequence and writes out the forward and reverse senses of the sequence with the 3 forward and three reverse translations in a pretty display format. It also writes a file containing the open reading frames that are larger than the specified minimum size (default 1 base, showing all possible open reading frames). These open reading frames are written as protein sequences in the default output sequence format. An open reading frame is defined in this program as any possible translation between two STOP codons.Algorithm The nucleic acid sequence is read in. The required genetic code is read in from the EGC* data files. The three forward and three reverse translations are created. The name and description are written to the ouput display file. Any required regions to be changed to upper case are changed. Any required regions to be highlighted in HTML colour tags are changed. The reverse sense sequence is placed below the forward sequence. The forward translations are placed above the sequences. The reverse translation are placed below the sequences. The display is written out, split at the ends of lines. Any ORFs that are longer than the specified minimum size are written to the output sequence file.Usage Here is a sample session with sixpack% sixpack Display a DNA sequence with 6-frame translation and ORFsInput nucleotide sequence: tembl:paamirOutput file [paamir.sixpack]: protein output sequence(s) [paamir.fasta]: Go to the input files for this example Go to the output files for this exampleCommand line arguments Standard (Mandatory) qualifiers: [-sequence] sequence Nucleotide sequence filename and optional format, or reference (input USA) [-outfile] outfile [*.sixpack] Output file name -outseq seqoutall [.] ORF sequence output Additional (Optional) qualifiers: -table menu [0] Genetics code used for the translation (Values: 0 (Standard); 1 (Standard (with alternative initiation codons)); 2 (Vertebrate Mitochondrial); 3 (Yeast Mitochondrial); 4 (Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma); 5 (Invertebrate Mitochondrial); 6 (Ciliate Macronuclear and Dasycladacean); 9 (Echinoderm Mitochondrial); 10 (Euplotid Nuclear); 11 (Bacterial); 12 (Alternative Yeast Nuclear); 13 (Ascidian Mitochondrial); 14 (Flatworm Mitochondrial); 15 (Blepharisma Macronuclear); 16 (Chlorophycean Mitochondrial); 21 (Trematode Mitochondrial); 22 (Scenedesmus obliquus); 23 (Thraustochytrium Mitochondrial)) -[no]firstorf boolean [Y] Count the beginning of a sequence as a possible ORF, even if it's inferior to the minimal ORF size. -[no]lastorf boolean [Y] Count the end of a sequence as a possible ORF, even if it's not finishing with a STOP, or inferior to the minimal ORF size. -mstart boolean [N] Displays only ORFs starting with an M. Advanced (Unprompted) qualifiers: -[no]reverse boolean [Y] Display also the translation of the DNA sequence in the 3 reverse frames -orfminsize integer [1] Minimum size of Open Reading Frames (ORFs) to display in the translations. (Integer 1 or more) -uppercase range [If this is left blank, then the sequence case is left alone.] Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 -highlight range [(full sequence)] Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24-45 blue 56-78 orange 1-100 green 120-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'. -[no]number boolean [Y] Number the sequence at the beginning and the end of each line. -width integer [60] Number of nucleotides displayed on each line (Integer 1 or more) -length integer [0] Line length of page (0 for indefinite) (Integer 0 or more) -margin integer [10] Margin around sequence for numbering. (Integer 0 or more) -[no]name boolean [Y] Set this to be false if you do not wish to display the ID name of the sequence. -[no]description boolean [Y] Set this to be false if you do not wish to display the description of the sequence. -offset integer [1] Number from which you want the DNA sequence to be numbered. (Any integer value) -html boolean [N] Use HTML formatting Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of the sequence to be used -send1 integer End of the sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory "-outseq" associated qualifiers -osformat string Output seq format -osextension string File name extension -osname string Base file name -osdirectory string Output directory -osdbname string Database name to add -ossingle boolean Separate file for each entry -oufo string UFO features -offormat string Features format -ofname string Features file name -ofdirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messagesInput file format sixpack reads any normal sequence USAs. Input files for usage example 'tembl:paamir' is a sequence entry in the example nucleic acid database 'tembl' Database entry: tembl:paamirID PAAMIR standard; DNA; PRO; 2167 BP.XXAC X13776; M43175;XXSV X13776.1XXDT 19-APR-1989 (Rel. 19, Created)DT 17-FEB-1997 (Rel. 50, Last updated, Version 22)XXDE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulationXXKW aliphatic amidase regulator; amiC gene; amiR gene.XXOS Pseudomonas aeruginosaOC Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas.XXRN [1]RP 1167-2167RA Rice P.M.;RT ;RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.XXRN [2]RP 1167-2167RX MEDLINE; 89211409.RA Lowe N., Rice P.M., Drew R.E.;RT "Nucleotide sequence of the aliphatic amidase regulator gene of PseudomonasRT aeruginosa";RL FEBS Lett. 246:39-43(1989).XXRN [3]RP 1-1292RX MEDLINE; 91317707.RA Wilson S., Drew R.;RT "Cloning and DNA seqence of amiC, a new gene regulating expression of theRT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiCRT product.";RL J. Bacteriol. 173:4914-4921(1991).XXRN [4]RP 1-2167RA Rice P.M.;RT ;RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.XXDR SWISS-PROT; P10932; AMIR_PSEAE.DR SWISS-PROT; P27017; AMIC_PSEAE.DR SWISS-PROT; Q51417; AMIS_PSEAE. [Part of this file has been deleted for brevity]FT phenotype"FT /replace=""FT /gene="amiC"FT misc_feature 1FT /note="last base of an XhoI site"FT misc_feature 648..653FT /note="end of 658bp XhoI fragment, deletion in pSW3 causesFT constitutive expression of amiE"FT conflict 1281FT /replace="g"FT /citation=[3]XXSQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other; ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60 ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120 aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180 aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240 agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300 ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360 tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420 agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480 acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540 ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600 gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660 acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720 cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780 ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840 aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900 acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960 tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020 tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080 acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140 gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200 agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260 ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320 cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380 gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440 gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500 gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560 cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620 tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680 gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740 ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800 gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860 aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920 catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980 gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040 gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100 ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160 cctcgag 2167//Output file format Output files for usage example File: paamir.sixpackPAAMIRPseudomonas aeruginosa amiC and amiR gene for aliphatic amidaseregulation G T A G R A S A R S P P A G R R E L H D F1 V P L A E H L L D H H Q P G D G N C T I F2 Y R W P S I C S I T T S R A T G T A R S F3 1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat 60 ----:----|----:----|----:----|----:----|----:----|----:----| 1 ccatggcgaccggctcgtagacgagctagtggtggtcggcccgctgcccttgacgtgcta 60 P V A P R A D A R D G G A P R R S S C S F6 X Y R Q G L M Q E I V V L R A V P V A R F5 T G S A S C R S S * W W G P S P F Q V I F4 L P G E P G A R A G S L R T A L S D S H F1 Y L A S L E H E R V R F V R R * A T V T F2 T W R A W S T S G F A S Y G A E R Q S Q F3
⌨️ 快捷键说明
复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?