primersearch.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 316 行

TXT
316
字号
                               primersearch Function   Searches DNA sequences for matches with primer pairsDescription   primersearch reads in primer pairs from an input file and searches   them against sequence(s) specified by the user. Each of the primers in   a pair is searched against the sequence and potential amplimers are   reported.   The user can specify a maximum percent mismatch level; for example,   10% mismatch on a primer of length 20bp means that the program will   classify a primer as matching a sequence if 18 of the 20 base pairs   matches.   It will only report matches if both primers in the pair have a match   in opposite orientations.Usage   Here is a sample session with primersearch% primersearch tembl:z52466 Searches DNA sequences for matches with primer pairsPrimer pairs file: primersAllowed percent mismatch [0]: Whitehead primer3_core program output file [hsa203yc1.primersearch]:    Go to the input files for this example   Go to the output files for this example   Example 2   Here we run the same example but allowing 20% mismatch between the   primers and the sequence:% primersearch tembl:z52466 Searches DNA sequences for matches with primer pairsPrimer pairs file: primersAllowed percent mismatch [0]: 20Whitehead primer3_core program output file [hsa203yc1.primersearch]:    Go to the output files for this exampleCommand line arguments   Standard (Mandatory) qualifiers:  [-seqall]            seqall     Nucleotide sequence(s) filename and optional                                  format, or reference (input USA)  [-infile]            infile     Primer pairs file  [-mismatchpercent]   integer    [0] Allowed percent mismatch (Any integer                                  value)  [-outfile]           outfile    [*.primersearch] Whitehead primer3_core                                  program output file   Additional (Optional) qualifiers: (none)   Advanced (Unprompted) qualifiers: (none)   Associated qualifiers:   "-seqall" associated qualifiers   -sbegin1            integer    Start of each sequence to be used   -send1              integer    End of each sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-outfile" associated qualifiers   -odirectory4        string     Output directory   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format   primersearch reads in any nucleic acid sequence USAs.  Input files for usage example   'tembl:z52466' is a sequence entry in the example nucleic acid   database 'tembl'  File: primers# This is my primer fileD1S243  cacacaggctcacatgcc      gctccagcgtcatggactD1S468 aattaaccgttttggtcct     gcgacacacacttcccD1S2845 ccaaagggtgcttctc        gtggcattccaacctcD1S1608 gatggcttttggggactatt    cactgagccaagtgacacagD1S2893 aaaacatcaactctcccctg    ctcaaaccccaataagccttD1S2660 cacacatgcacatgcac       agtgacaccagcaggg  Database entry: tembl:z52466ID   HSA203YC1  standard; DNA; STS; 389 BP.XXAC   Z52466;XXSV   Z52466.1XXDT   18-MAR-1996 (Rel. 47, Created)DT   23-MAR-1996 (Rel. 47, Last updated, Version 3)XXDE   H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1;DE   single read.XXKW   CA repeat; dinucleotide repeat; GT repeat; microsatellite DNA;KW   microsatellite marker; repeat polymorphism; STS.XXOS   Homo sapiens (human)OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;OC   Eutheria; Primates; Catarrhini; Hominidae; Homo.XXRN   [1]RP   1-389RA   Weissenbach J.;RT   ;RL   Submitted (01-SEP-1995) to the EMBL/GenBank/DDBJ databases.RL   Genethon, B.P. 60, 91002 Evry Cedex France. E-mail:RL   Jean.Weissenbach@genethon.frXXRN   [2]RP   1-389RX   MEDLINE; 96176476.RA   Dib C., Faure S., Fizames C., Samson D., Drouot N., Vignal A.,RA   Millasseau P., Marc S., Hazan J., Seboun E., Lathrop M., Gyapay G.,RA   Morissette J., Weissenbach J.;RT   "A comprehensive genetic map of the human genome based on 5,264RT   microsatellites";RL   Nature 380:152-154(1996).XXCC   full automatic;XXFH   Key             Location/QualifiersFHFT   source          1..389FT                   /chromosome="1"FT                   /db_xref="taxon:9606"FT                   /note="cloning vector is M13mp18"FT                   /organism="Homo sapiens"FT                   /cell_line="CEPH 134702"FT                   /clone_lib="genomic DNA"XXSQ   Sequence 389 BP; 118 A; 124 C; 86 G; 57 T; 4 other;     agctgtgtgc acacaacatg anggggcaca catgcacatg cacacatgcc cacatgcata        60     tgcacacaca cacacacaca cacacacaca ttcatgccca agcacgccca ccctcatgtc       120     tcaccatgtg cacataacac acagtcacat ataccctggc acacatgccc acatgcagac       180     acgaaacaca ggcccacgnt tncatgcaca caggtatggg cacacatacc atgcacacat       240     aangacaaat accaggccag acatgatttg cccctgctgg tgtcactgtt aagtgtgaca       300     gacaagcaga ggacacacac ccacctggga cgcggggctt caggagagag gcagacctaa       360     tagggcccgg attcggggct ggggaggct                                         389//   The input primer file has the following format:   Comment lines start with a '#'   Lines with primer information have three fields separated by spaces or   TAB characters. The columns contain:    1. The name of the primer pair - this is reported in the output.    2. The sequence of the first primer.    3. The sequence of the second primer.   Empty files will cause primersearch to note that no primers have been   found, and to exit.Output file format  Output files for usage example  File: hsa203yc1.primersearchPrimer name D1S243Primer name D1S468Primer name D1S2845Primer name D1S1608Primer name D1S2893Primer name D1S2660Amplimer 1        Sequence: HSA203YC1 Z52466        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches        Amplimer length: 261 bp  Output files for usage example 2  File: hsa203yc1.primersearchPrimer name D1S243Primer name D1S468Primer name D1S2845Primer name D1S1608Primer name D1S2893Primer name D1S2660Amplimer 1        Sequence: HSA203YC1 Z52466        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.        CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches        Amplimer length: 239 bpAmplimer 2        Sequence: HSA203YC1 Z52466        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches        Amplimer length: 261 bpData files   None.Notes   Every potential amplimer will be reported; if one primer matches the   forward strand twice and the other matches the reverse strand only   once, two potential amplimers are reported. If the reverse primer   matches twice, four potential amplimers are reported.   Each primer pair consists of a name, followed by two primer sequences,   primerA and primerB. The program first compares primerA to the forward   strand and if it matches, primerB is compared to the reverse strand.   The approach is then reversed, with the primerB being compared to the   forward strand and primerA to the reverse. In this way all possible   amplimers are reported.References   None.Warnings   This program is slow.   Don't try searching all of EMBL!   It might not be sensible to search all of the human section of EMBL -   in 2000, this would take a day to do with one primer pair.   It will take longer with more primer pairs.   It will take longer if you allow mismatches.Diagnostic Error Messages   "No suitable primers found - exiting" means that either the primers   file was empty or there were no compilable primer pairs contained in   it.Exit status   It always exits with status 0Known bugs   None.See also   Program name                         Description   eprimer3     Picks PCR primers and hybridization oligos   stssearch    Search a DNA database for matches with a set of STS primers   stssearch does something similar, but doesn't allow you to find   mismatches and will report any match in any orientation and doesn't   require you to have both primers matching.Author(s)   Val Curwen (vac 

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?