trimseq.txt

来自「emboss的linux版本的源代码」· 文本 代码 · 共 325 行

TXT
325
字号
                                  trimseq Function   Trim ambiguous bits off the ends of sequencesDescription   This program is used to tidy up the ends of sequences, removing all   the bits that you would really rather were not published.   Specifically, it:     * removes all gap characters from the ends.     * removes X's and N's (in nucleic sequences) from the ends.     * optionally removes *'s from the ends     * optionally removes IUPAC ambiguity codes from the ends (B and Z in       proteins, M,R,W,S,Y,K,V,H,D and B in nucleic sequences)   It then optionally trims off poor quality regions from the end, using   a threshold percentage of unwanted characters in a window which is   moved along the sequence from the ends. The unwanted characters which   are used are X's and N's (in nucleic sequences), optionally *'s, and   optionally IUPAC ambiguity codes.   The program stops trimming the ends when the percentage of unwanted   characters in the moving window drops below the threshold percentage.   Thus if the window size is set to 1 and the percentage threshold is   100, no further poor quality regions will be removed. If the window   size is set to 5 and the percentage threshold is 40 then the sequence   AAGCTNNNNATT will be trimmed to AAGCT, while AAGCTNATT or   AAGCTNNNNATTT will not be trimmed as less than 40% of the last 5   characters are N's.   After trimming these poor quality regions, it will again then trim off   any dangling gap characters from the ends .Usage   Here is a sample session with trimseq% trimseq untrimmed.seq trim1.seq -window 1 -percent 100 Trim ambiguous bits off the ends of sequences   Go to the input files for this example   Go to the output files for this example   Example 2% trimseq untrimmed.seq trim2.seq -window 5 -percent 40 Trim ambiguous bits off the ends of sequences   Go to the output files for this example   Example 3% trimseq untrimmed.seq trim3.seq -window 5 -percent 50 Trim ambiguous bits off the ends of sequences   Go to the output files for this example   Example 4% trimseq untrimmed.seq trim4.seq -window 5 -percent 50 -strict Trim ambiguous bits off the ends of sequences   Go to the output files for this example   Example 5% trimseq untrimmed.seq trim5.seq -window 5 -percent 50 -strict -noright Trim ambiguous bits off the ends of sequences   Go to the output files for this exampleCommand line arguments   Standard (Mandatory) qualifiers:  [-sequence]          seqall     (Gapped) sequence(s) filename and optional                                  format, or reference (input USA)  [-outseq]            seqoutall  [.] Sequence set(s)                                  filename and optional format (output USA)   Additional (Optional) qualifiers:   -window             integer    [1] This determines the size of the region                                  that is considered when deciding whether the                                  percentage of ambiguity is greater than the                                  threshold. A value of 5 means that a region                                  of 5 letters in the sequence is shifted                                  along the sequence from the ends and                                  trimming is done only if there is a greater                                  or equal percentage of ambiguity than the                                  threshold percentage. (Any integer value)   -percent            float      [100.0] This is the threshold of the                                  percentage ambiguity in the window required                                  in order to trim a sequence. (Any numeric                                  value)   -strict             boolean    [N] In nucleic sequences, trim off not only                                  N's and X's, but also the nucleotide IUPAC                                  ambiguity codes M, R, W, S, Y, K, V, H, D                                  and B. In protein sequences, trim off not                                  only X's but also B and Z.   -star               boolean    [N] In protein sequences, trim off not only                                  X's, but also the *'s   Advanced (Unprompted) qualifiers:   -[no]left           boolean    [Y] Trim at the start   -[no]right          boolean    [Y] Trim at the end   Associated qualifiers:   "-sequence" associated qualifiers   -sbegin1            integer    Start of each sequence to be used   -send1              integer    End of each sequence to be used   -sreverse1          boolean    Reverse (if DNA)   -sask1              boolean    Ask for begin/end/reverse   -snucleotide1       boolean    Sequence is nucleotide   -sprotein1          boolean    Sequence is protein   -slower1            boolean    Make lower case   -supper1            boolean    Make upper case   -sformat1           string     Input sequence format   -sdbname1           string     Database name   -sid1               string     Entryname   -ufo1               string     UFO features   -fformat1           string     Features format   -fopenfile1         string     Features file name   "-outseq" associated qualifiers   -osformat2          string     Output seq format   -osextension2       string     File name extension   -osname2            string     Base file name   -osdirectory2       string     Output directory   -osdbname2          string     Database name to add   -ossingle2          boolean    Separate file for each entry   -oufo2              string     UFO features   -offormat2          string     Features format   -ofname2            string     Features file name   -ofdirectory2       string     Output directory   General qualifiers:   -auto               boolean    Turn off prompts   -stdout             boolean    Write standard output   -filter             boolean    Read standard input, write standard output   -options            boolean    Prompt for standard and additional values   -debug              boolean    Write debug output to program.dbg   -verbose            boolean    Report some/full command line options   -help               boolean    Report command line options. More                                  information on associated and general                                  qualifiers can be found with -help -verbose   -warning            boolean    Report warnings   -error              boolean    Report errors   -fatal              boolean    Report fatal errors   -die                boolean    Report dying program messagesInput file format   Normal sequence.  Input files for usage example  File: untrimmed.seq>myseq...ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca.gnntcynnnnnnOutput file format   Normal sequence file.  Output files for usage example  File: trim1.seq>myseqttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntcy  Output files for usage example 2  File: trim2.seq>myseqttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-g  Output files for usage example 3  File: trim3.seq>myseqttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntcy  Output files for usage example 4  File: trim4.seq>myseqctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntc  Output files for usage example 5  File: trim5.seq>myseqctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntcynnnnnnData files   None.Notes   If you use the '-star' qualifier and set the window size to greater   than 1, you may trim bits of sequence with internal *'s. This may not   be what you expected.References   None.Warnings   None.Diagnostic Error Messages   None.Exit status   It always exits with status 0.Known bugs   None noted.See also   Program name                         Description   biosed       Replace or delete sequence sections   codcopy      Reads and writes a codon usage table   cutseq       Removes a specified section from a sequence   degapseq     Removes gap characters from sequences   descseq      Alter the name or description of a sequence   entret       Reads and writes (returns) flatfile entries   extractalign Extract regions from a sequence alignment   extractfeat  Extract features from a sequence   extractseq   Extract regions from a sequence   listor       Write a list file of the logical OR of two sets of sequences   makenucseq   Creates random nucleotide sequences   makeprotseq  Creates random protein sequences   maskfeat     Mask off features of a sequence   maskseq      Mask off regions of a sequence   newseq       Type in a short new sequence   noreturn     Removes carriage return from ASCII files   notseq       Exclude a set of sequences and write out the remaining ones   nthseq       Writes one sequence from a multiple set of sequences   pasteseq     Insert one sequence into another   revseq       Reverse and complement a sequence   seqret       Reads and writes (returns) sequences   seqretsplit  Reads and writes (returns) sequences in individual files   skipseq      Reads and writes (returns) sequences, skipping first few   splitter     Split a sequence into (overlapping) smaller sequences   trimest      Trim poly-A tails off EST sequences   union        Reads sequence fragments and builds one sequence   vectorstrip  Strips out DNA between a pair of vector sequences   yank         Reads a sequence range, appends the full USA to a list fileAuthor(s)   Gary Williams (gwilliam 

⌨️ 快捷键说明

复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?