trimseq.txt
来自「emboss的linux版本的源代码」· 文本 代码 · 共 325 行
TXT
325 行
trimseq Function Trim ambiguous bits off the ends of sequencesDescription This program is used to tidy up the ends of sequences, removing all the bits that you would really rather were not published. Specifically, it: * removes all gap characters from the ends. * removes X's and N's (in nucleic sequences) from the ends. * optionally removes *'s from the ends * optionally removes IUPAC ambiguity codes from the ends (B and Z in proteins, M,R,W,S,Y,K,V,H,D and B in nucleic sequences) It then optionally trims off poor quality regions from the end, using a threshold percentage of unwanted characters in a window which is moved along the sequence from the ends. The unwanted characters which are used are X's and N's (in nucleic sequences), optionally *'s, and optionally IUPAC ambiguity codes. The program stops trimming the ends when the percentage of unwanted characters in the moving window drops below the threshold percentage. Thus if the window size is set to 1 and the percentage threshold is 100, no further poor quality regions will be removed. If the window size is set to 5 and the percentage threshold is 40 then the sequence AAGCTNNNNATT will be trimmed to AAGCT, while AAGCTNATT or AAGCTNNNNATTT will not be trimmed as less than 40% of the last 5 characters are N's. After trimming these poor quality regions, it will again then trim off any dangling gap characters from the ends .Usage Here is a sample session with trimseq% trimseq untrimmed.seq trim1.seq -window 1 -percent 100 Trim ambiguous bits off the ends of sequences Go to the input files for this example Go to the output files for this example Example 2% trimseq untrimmed.seq trim2.seq -window 5 -percent 40 Trim ambiguous bits off the ends of sequences Go to the output files for this example Example 3% trimseq untrimmed.seq trim3.seq -window 5 -percent 50 Trim ambiguous bits off the ends of sequences Go to the output files for this example Example 4% trimseq untrimmed.seq trim4.seq -window 5 -percent 50 -strict Trim ambiguous bits off the ends of sequences Go to the output files for this example Example 5% trimseq untrimmed.seq trim5.seq -window 5 -percent 50 -strict -noright Trim ambiguous bits off the ends of sequences Go to the output files for this exampleCommand line arguments Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [.] Sequence set(s) filename and optional format (output USA) Additional (Optional) qualifiers: -window integer [1] This determines the size of the region that is considered when deciding whether the percentage of ambiguity is greater than the threshold. A value of 5 means that a region of 5 letters in the sequence is shifted along the sequence from the ends and trimming is done only if there is a greater or equal percentage of ambiguity than the threshold percentage. (Any integer value) -percent float [100.0] This is the threshold of the percentage ambiguity in the window required in order to trim a sequence. (Any numeric value) -strict boolean [N] In nucleic sequences, trim off not only N's and X's, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B. In protein sequences, trim off not only X's but also B and Z. -star boolean [N] In protein sequences, trim off not only X's, but also the *'s Advanced (Unprompted) qualifiers: -[no]left boolean [Y] Trim at the start -[no]right boolean [Y] Trim at the end Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messagesInput file format Normal sequence. Input files for usage example File: untrimmed.seq>myseq...ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca.gnntcynnnnnnOutput file format Normal sequence file. Output files for usage example File: trim1.seq>myseqttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntcy Output files for usage example 2 File: trim2.seq>myseqttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-g Output files for usage example 3 File: trim3.seq>myseqttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntcy Output files for usage example 4 File: trim4.seq>myseqctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntc Output files for usage example 5 File: trim5.seq>myseqctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaataaaaaagccacttagttca-gnntcynnnnnnData files None.Notes If you use the '-star' qualifier and set the window size to greater than 1, you may trim bits of sequence with internal *'s. This may not be what you expected.References None.Warnings None.Diagnostic Error Messages None.Exit status It always exits with status 0.Known bugs None noted.See also Program name Description biosed Replace or delete sequence sections codcopy Reads and writes a codon usage table cutseq Removes a specified section from a sequence degapseq Removes gap characters from sequences descseq Alter the name or description of a sequence entret Reads and writes (returns) flatfile entries extractalign Extract regions from a sequence alignment extractfeat Extract features from a sequence extractseq Extract regions from a sequence listor Write a list file of the logical OR of two sets of sequences makenucseq Creates random nucleotide sequences makeprotseq Creates random protein sequences maskfeat Mask off features of a sequence maskseq Mask off regions of a sequence newseq Type in a short new sequence noreturn Removes carriage return from ASCII files notseq Exclude a set of sequences and write out the remaining ones nthseq Writes one sequence from a multiple set of sequences pasteseq Insert one sequence into another revseq Reverse and complement a sequence seqret Reads and writes (returns) sequences seqretsplit Reads and writes (returns) sequences in individual files skipseq Reads and writes (returns) sequences, skipping first few splitter Split a sequence into (overlapping) smaller sequences trimest Trim poly-A tails off EST sequences union Reads sequence fragments and builds one sequence vectorstrip Strips out DNA between a pair of vector sequences yank Reads a sequence range, appends the full USA to a list fileAuthor(s) Gary Williams (gwilliam
⌨️ 快捷键说明
复制代码Ctrl + C
搜索代码Ctrl + F
全屏模式F11
增大字号Ctrl + =
减小字号Ctrl + -
显示快捷键?