perlretut.pod

视频监控网络部分的协议ddns,的模块的实现代码,请大家大胆指正.

C<\d+> and the sign can be matched with C<[+-]>.  Thus the integer
regexp is

    /[+-]?\d+/;  # matches integers

A floating point number potentially has a sign, an integral part, a
decimal point, a fractional part, and an exponent.  One or more of these
parts is optional, so we need to check out the different
possibilities.  Floating point numbers which are in proper form include
123., 0.345, .34, -1e6, and 25.4E-72.  As with integers, the sign out
front is completely optional and can be matched by C<[+-]?>.  We can
see that if there is no exponent, floating point numbers must have a
decimal point, otherwise they are integers.  We might be tempted to
model these with C<\d*\.\d*>, but this would also match just a single
decimal point, which is not a number.  So the three cases of floating
point number without exponent are

   /[+-]?\d+\./;  # 1., 321., etc.
   /[+-]?\.\d+/;  # .1, .234, etc.
   /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

These can be combined into a single regexp with a three-way alternation:

   /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

In this alternation, it is important to put C<'\d+\.\d+'> before
C<'\d+\.'>.  If C<'\d+\.'> were first, the regexp would happily match that
and ignore the fractional part of the number.

Now consider floating point numbers with exponents.  The key
observation here is that I<both> integers and numbers with decimal
points are allowed in front of an exponent.  Then exponents, like the
overall sign, are independent of whether we are matching numbers with
or without decimal points, and can be 'decoupled' from the
mantissa.  The overall form of the regexp now becomes clear:

    /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

The exponent is an C<e> or C<E>, followed by an integer.  So the
exponent regexp is

   /[eE][+-]?\d+/;  # exponent

Putting all the parts together, we get a regexp that matches numbers:

   /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

Long regexps like this may impress your friends, but can be hard to
decipher.  In complex situations like this, the C<//x> modifier for a
match is invaluable.  It allows one to put nearly arbitrary whitespace
and comments into a regexp without affecting their meaning.  Using it,
we can rewrite our 'extended' regexp in the more pleasing form

   /^
      [+-]?         # first, match an optional sign
      (             # then match integers or f.p. mantissas:
          \d+\.\d+  # mantissa of the form a.b
         |\d+\.     # mantissa of the form a.
         |\.\d+     # mantissa of the form .b
         |\d+       # integer of the form a
      )
      ([eE][+-]?\d+)?  # finally, optionally match an exponent
   $/x;

If whitespace is mostly irrelevant, how does one include space
characters in an extended regexp? The answer is to backslash it
S<C<'\ '>> or put it in a character class S<C<[ ]>>.  The same thing
goes for pound signs, use C<\#> or C<[#]>.  For instance, Perl allows
a space between the sign and the mantissa or integer, and we could add
this to our regexp as follows:

   /^
      [+-]?\ *      # first, match an optional sign *and space*
      (             # then match integers or f.p. mantissas:
          \d+\.\d+  # mantissa of the form a.b
         |\d+\.     # mantissa of the form a.
         |\.\d+     # mantissa of the form .b
         |\d+       # integer of the form a
      )
      ([eE][+-]?\d+)?  # finally, optionally match an exponent
   $/x;

In this form, it is easier to see a way to simplify the
alternation.  Alternatives 1, 2, and 4 all start with C<\d+>, so it
could be factored out:

   /^
      [+-]?\ *      # first, match an optional sign
      (             # then match integers or f.p. mantissas:
          \d+       # start out with a ...
          (
              \.\d* # mantissa of the form a.b or a.
          )?        # ? takes care of integers of the form a
         |\.\d+     # mantissa of the form .b
      )
      ([eE][+-]?\d+)?  # finally, optionally match an exponent
   $/x;

or written in the compact form,

    /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

This is our final regexp.  To recap, we built a regexp by

=over 4

=item *

specifying the task in detail,

=item *

breaking down the problem into smaller parts,

=item *

translating the small parts into regexps,

=item *

combining the regexps,

=item *

and optimizing the final combined regexp.

=back

These are also the typical steps involved in writing a computer
program.  This makes perfect sense, because regular expressions are
essentially programs written in a little computer language that specifies
patterns.

=head2 Using regular expressions in Perl

The last topic of Part 1 briefly covers how regexps are used in Perl
programs.  Where do they fit into Perl syntax?

We have already introduced the matching operator in its default
C</regexp/> and arbitrary delimiter C<m!regexp!> forms.  We have used
the binding operator C<=~> and its negation C<!~> to test for string
matches.  Associated with the matching operator, we have discussed the
single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
extended C<//x> modifiers.  There are a few more things you might
want to know about matching operators.

=head3 Optimizing pattern evaluation

We pointed out earlier that variables in regexps are substituted
before the regexp is evaluated:

    $pattern = 'Seuss';
    while (<>) {
        print if /$pattern/;
    }

This will print any lines containing the word C<Seuss>.  It is not as
efficient as it could be, however, because Perl has to re-evaluate
(or compile) C<$pattern> each time through the loop.  If C<$pattern> won't be
changing over the lifetime of the script, we can add the C<//o>
modifier, which directs Perl to only perform variable substitutions
once:

    #!/usr/bin/perl
    #    Improved simple_grep
    $regexp = shift;
    while (<>) {
        print if /$regexp/o;  # a good deal faster
    }


=head3 Prohibiting substitution

If you change C<$pattern> after the first substitution happens, Perl
will ignore it.  If you don't want any substitutions at all, use the
special delimiter C<m''>:

    @pattern = ('Seuss');
    while (<>) {
        print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
    }

Similar to strings, C<m''> acts like apostrophes on a regexp; all other
C<m> delimiters act like quotes.  If the regexp evaluates to the empty string,
the regexp in the I<last successful match> is used instead.  So we have

    "dog" =~ /d/;  # 'd' matches
    "dogbert =~ //;  # this matches the 'd' regexp used before


=head3 Global matching

The final two modifiers C<//g> and C<//c> concern multiple matches.
The modifier C<//g> stands for global matching and allows the
matching operator to match within a string as many times as possible.
In scalar context, successive invocations against a string will have
`C<//g> jump from match to match, keeping track of position in the
string as it goes along.  You can get or set the position with the
C<pos()> function.

The use of C<//g> is shown in the following example.  Suppose we have
a string that consists of words separated by spaces.  If we know how
many words there are in advance, we could extract the words using
groupings:

    $x = "cat dog house"; # 3 words
    $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                           # $1 = 'cat'
                                           # $2 = 'dog'
                                           # $3 = 'house'

But what if we had an indeterminate number of words? This is the sort
of task C<//g> was made for.  To extract all words, form the simple
regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:

    while ($x =~ /(\w+)/g) {
        print "Word is $1, ends at position ", pos $x, "\n";
    }

prints

    Word is cat, ends at position 3
    Word is dog, ends at position 7
    Word is house, ends at position 13

A failed match or changing the target string resets the position.  If
you don't want the position reset after failure to match, add the
C<//c>, as in C</regexp/gc>.  The current position in the string is
associated with the string, not the regexp.  This means that different
strings have different positions and their respective positions can be
set or read independently.

In list context, C<//g> returns a list of matched groupings, or if
there are no groupings, a list of matches to the whole regexp.  So if
we wanted just the words, we could use

    @words = ($x =~ /(\w+)/g);  # matches,
                                # $word[0] = 'cat'
                                # $word[1] = 'dog'
                                # $word[2] = 'house'

Closely associated with the C<//g> modifier is the C<\G> anchor.  The
C<\G> anchor matches at the point where the previous C<//g> match left
off.  C<\G> allows us to easily do context-sensitive matching:

    $metric = 1;  # use metric units
    ...
    $x = <FILE>;  # read in measurement
    $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
    $weight = $1;
    if ($metric) { # error checking
        print "Units error!" unless $x =~ /\Gkg\./g;
    }
    else {
        print "Units error!" unless $x =~ /\Glbs\./g;
    }
    $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

The combination of C<//g> and C<\G> allows us to process the string a
bit at a time and use arbitrary Perl logic to decide what to do next.
Currently, the C<\G> anchor is only fully supported when used to anchor
to the start of the pattern.

C<\G> is also invaluable in processing fixed length records with
regexps.  Suppose we have a snippet of coding region DNA, encoded as
base pair letters C<ATCGTTGAAT...> and we want to find all the stop
codons C<TGA>.  In a coding region, codons are 3-letter sequences, so
we can think of the DNA snippet as a sequence of 3-letter records.  The
naive regexp

    # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
    $dna = "ATCGTTGAATGCAAATGACATGAC";
    $dna =~ /TGA/;

doesn't work; it may match a C<TGA>, but there is no guarantee that
the match is aligned with codon boundaries, e.g., the substring
S<C<GTT GAA>> gives a match.  A better solution is

    while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
        print "Got a TGA stop codon at position ", pos $dna, "\n";
    }

which prints

    Got a TGA stop codon at position 18
    Got a TGA stop codon at position 23

Position 18 is good, but position 23 is bogus.  What happened?

The answer is that our regexp works well until we get past the last
real match.  Then the regexp will fail to match a synchronized C<TGA>
and start stepping ahead one character position at a time, not what we
want.  The solution is to use C<\G> to anchor the match to the codon
alignment:

    while ($dna =~ /\G(\w\w\w)*?TGA/g) {
        print "Got a TGA stop codon at position ", pos $dna, "\n";
    }

This prints

    Got a TGA stop codon at position 18

which is the correct answer.  This example illustrates that it is
important not only to match what is desired, but to reject what is not
desired.

=head3 Search and replace

Regular expressions also play a big role in I<search and replace>
operations in Perl.  Search and replace is accomplished with the
C<s///> operator.  The general form is
C<s/regexp/replacement/modifiers>, with everything we know about
regexps and modifiers applying in this case as well.  The
C<replacement> is a Perl double quoted string that replaces in the
string whatever is matched with the C<regexp>.  The operator C<=~> is
also used here to associate a string with C<s///>.  If matching
against C<$_>, the S<C<$_ =~>> can be dropped.  If there is a match,
C<s///> returns the number of substitutions made, otherwise it returns
false.  Here are a few examples:

    $x = "Time to feed the cat!";
    $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
    if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
        $more_insistent = 1;
    }
    $y = "'quoted words'";
    $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                           # $y contains "quoted words"

In the last example, the whole string was matched, but only the part
inside the single quotes was grouped.  With the C<s///> operator, the
matched variables C<$1>, C<$2>, etc.  are immediately available for use
in the replacemen