test_helper.cpp

ncbi源码

                auto_ptr<CObjectOStream>
                    out(CObjectOStream::Open(eSerial_AsnText, NcbiCout));
                *out << feat_it->GetMappedFeature();
            }
            //### _ASSERT(feat_it->
        }
        if ( sm_DumpFeatures ) {
            NcbiCout << "-------------------- "
                "product CFeat_CI --------------------" << NcbiEndl;
        }
        // Get products
        for ( CFeat_CI feat_it(handle, 0, 0,
                               SAnnotSelector()
                               .SetLimitTSE(&handle.GetTopLevelSeqEntry())
                               .SetByProduct());
              feat_it;  ++feat_it) {
            count++;
            annot_set.insert(&feat_it.GetSeq_annot());
            if ( sm_DumpFeatures ) {
                auto_ptr<CObjectOStream>
                    out(CObjectOStream::Open(eSerial_AsnText, NcbiCout));
                *out << feat_it->GetMappedFeature();
            }
            //### _ASSERT(feat_it->
        }
    }
    if ( sm_DumpFeatures ) {
        NcbiCout << "-------------------- "
            "end CFeat_CI --------------------" << NcbiEndl;
    }
    _ASSERT(count == seq_feat_cnt);
    _ASSERT(annot_set.size() == feat_annots_cnt);
    CHECK_END("get annot set");

    CHECK_WRAP();
    // Test CSeq_feat iterator for the specified range
    // Copy location seq-id
    count = 0;
    set<const CSeq_annot*> annot_set;
    CSeq_loc loc;
    loc.SetInt().SetId().Assign(id);
    loc.SetInt().SetFrom(0);
    loc.SetInt().SetTo(10);
    if ( !tse_feat_test ) {
        for ( CFeat_CI feat_it(scope, loc);
              feat_it;  ++feat_it) {
            count++;
            annot_set.insert(&feat_it.GetSeq_annot());
            //### _ASSERT(feat_it->
        }
    }
    else {
        for ( CFeat_CI feat_it(handle, 0, 10,
                               SAnnotSelector()
                               .SetLimitTSE(&handle.GetTopLevelSeqEntry()));
              feat_it;  ++feat_it) {
            count++;
            annot_set.insert(&feat_it.GetSeq_annot());
            //### _ASSERT(feat_it->
        }
    }
    _ASSERT(count == seq_featrg_cnt);
    _ASSERT(annot_set.size() == featrg_annots_cnt);
    CHECK_END("get annot set");

    CHECK_WRAP();
    // Test CSeq_align iterator
    count = 0;
    set<const CSeq_annot*> annot_set;
    CSeq_loc loc;
    loc.SetWhole(id);
    if ( !tse_feat_test ) {
        for (CAlign_CI align_it(scope, loc);
             align_it;  ++align_it) {
            count++;
            annot_set.insert(&align_it.GetSeq_annot());
            //### _ASSERT(align_it->
        }
    }
    else {
        for (CAlign_CI align_it(handle, 0, 0,
                                SAnnotSelector()
                                .SetLimitTSE(&handle.GetTopLevelSeqEntry()));
             align_it;  ++align_it) {
            count++;
            annot_set.insert(&align_it.GetSeq_annot());
            //### _ASSERT(align_it->
        }
    }
    _ASSERT(count == seq_align_cnt);
    _ASSERT(annot_set.size() == align_annots_cnt);
    CHECK_END("get align set");

    CHECK_WRAP();
    // Test CSeq_align iterator for the specified range
    // Copy location seq-id
    count = 0;
    set<const CSeq_annot*> annot_set;
    CSeq_loc loc;
    loc.SetInt().SetId().Assign(id);
    loc.SetInt().SetFrom(10);
    loc.SetInt().SetTo(20);
    if ( !tse_feat_test ) {
        for (CAlign_CI align_it(scope, loc);
             align_it;  ++align_it) {
            count++;
            annot_set.insert(&align_it.GetSeq_annot());
            //### _ASSERT(align_it->
        }
    }
    else {
        for (CAlign_CI align_it(handle, 10, 20,
                                SAnnotSelector()
                                .SetLimitTSE(&handle.GetTopLevelSeqEntry()));
             align_it;  ++align_it) {
            count++;
            annot_set.insert(&align_it.GetSeq_annot());
            //### _ASSERT(align_it->
        }
    }
    _ASSERT(count == seq_alignrg_cnt);
    _ASSERT(annot_set.size() == alignrg_annots_cnt);
    CHECK_END("get align set");
    if ( sm_TestRemoveEntry ) {
        CHECK_WRAP();
        CRef<CSeq_entry> tse
            (const_cast<CSeq_entry*>(&handle.GetTopLevelSeqEntry()));
        
        CRef<CSeq_entry> entry(const_cast<CSeq_entry*>(
                                   handle.GetBioseq().GetParentEntry()));
        CSeq_entry* parent = entry->GetParentEntry();
        scope.RemoveEntry(*entry);
        handle = scope.GetBioseqHandle(id);
        _ASSERT(!handle  ||  handle.GetBioseq().GetParentEntry() != entry);
        if ( parent ) {
            // Non-TSE
            scope.AttachEntry(*parent, *entry);
        }
        else {
            // TSE
            scope.AddTopLevelSeqEntry(*entry);
        }
        handle = scope.GetBioseqHandle(id);
        _ASSERT(handle);
        CHECK_END_ALWAYS("remove/attach seq-entry");
    }
}


void CTestHelper::TestDataRetrieval(CScope& scope, int idx,
                                    int delta)
{
    CSeq_id id;
    // find seq. by local id
    id.SetLocal().SetStr("seq" + NStr::IntToString(11+idx*1000));
    // iterate through the whole Scope
    ProcessBioseq(scope, id, 40,
        "CAGCAGCGGTACAGGAGGGTGAGACATCCCAGAGCGGTGC",
        "GTCGTCGCCATGTCCTCCCACTCTGTAGGGTCTCGCCACG",
        2, 4+delta, 4+delta, 2+delta, 1, 0, 2+delta, 2+delta, 1, 0);
    // iterate through the specific sequence only
    ProcessBioseq(scope, id, 40,
        "CAGCAGCGGTACAGGAGGGTGAGACATCCCAGAGCGGTGC",
        "GTCGTCGCCATGTCCTCCCACTCTGTAGGGTCTCGCCACG",
        2, -1, 2+delta, 1+delta, 1, 0, 1+delta, 1+delta, 1, 0, true);
    // find seq. by GI
    id.SetGi(12+idx*1000);
    ProcessBioseq(scope, id, 40,
        "CAATAACCTCAGCAGCAACAAGTGGCTTCCAGCGCCCTCC",
        "GTTATTGGAGTCGTCGTTGTTCACCGAAGGTCGCGGGAGG",
        1, 2, 3, 1, 1, 1, 2, 1, 1, 1); //1, 3, 2, 1, 1, 2, 2, 1, 1);
    // segmented sequence
    id.SetGi(21+idx*1000);
    ProcessBioseq(scope, id, 62,
        "CAGCACAATAACCTCAGCAGCAACAAGTGGCTTCCAGCGCCCTCCCAGCACAATAAAAAAAA",
        "GTCGTGTTATTGGAGTCGTCGTTGTTCACCGAAGGTCGCGGGAGGGTCGTGTTATTTTTTTT",
        1, 6+delta, 2, 1, 0, 0, 1, 1, 0, 0);
    id.SetGi(22+idx*1000);
    ProcessBioseq(scope, id, 20, "QGCGEQTMTLLAPTLAASRY", "",
        0, 0, 0, 0, 0, 0, 0, 0, 0, 0);
    // another seq.data format
    id.SetGi(23+idx*1000);
    ProcessBioseq(scope, id, 13,
        "\\x00\\x03\\x02\\x01\\x00\\x02\\x01\\x03\\x02\\x03\\x00\\x01\\x02",
        "\\x03\\x00\\x01\\x02\\x03\\x01\\x02\\x00\\x01\\x00\\x03\\x02\\x01",
        0, 0, 0, 0, 0, 0, 0, 0, 0, 0);
}

END_SCOPE(objects)
END_NCBI_SCOPE

/*
* ===========================================================================
*
* $Log: test_helper.cpp,v $
* Revision 1000.4  2004/06/01 19:25:11  gouriano
* PRODUCTION: UPGRADED [GCC34_MSVC7] Dev-tree R1.58
*
* Revision 1.58  2004/05/21 21:42:14  gorelenk
* Added PCH ncbi_pch.hpp
*
* Revision 1.57  2004/04/01 20:18:12  grichenk
* Added initialization of m_MultiId member.
*
* Revision 1.56  2004/03/31 22:35:17  grichenk
* Fixed number of features found
*
* Revision 1.55  2004/03/24 18:30:30  vasilche
* Fixed edit API.
* Every *_Info object has its own shallow copy of original object.
*
* Revision 1.54  2004/03/23 15:14:01  vasilche
* Restored automatic call to Parentize() for Seq-entries in object manager.
*
* Revision 1.53  2004/03/18 16:30:24  grichenk
* Changed type of seq-align containers from list to vector.
*
* Revision 1.52  2004/03/16 15:47:28  vasilche
* Added CBioseq_set_Handle and set of EditHandles
*
* Revision 1.51  2004/02/09 19:18:55  grichenk
* Renamed CDesc_CI to CSeq_descr_CI. Redesigned CSeq_descr_CI
* and CSeqdesc_CI to avoid using data directly.
*
* Revision 1.50  2004/02/03 17:58:50  vasilche
* Always test CScope::RemoveEntry() in single thread.
*
* Revision 1.49  2003/12/22 22:32:10  grichenk
* Enabled RemoveEntry/AttachEntry test in non-MT builds.
*
* Revision 1.48  2003/12/18 18:14:47  grichenk
* Removed test for CScope::RemoveEntry() since it breaks MT test.
*
* Revision 1.47  2003/12/18 16:38:07  grichenk
* Added CScope::RemoveEntry()
*
* Revision 1.46  2003/11/10 18:12:09  grichenk
* Removed extra EFlags declaration from seq_map_ci.hpp
*
* Revision 1.45  2003/11/04 16:21:37  grichenk
* Updated CAnnotTypes_CI to map whole features instead of splitting
* them by sequence segments.
*
* Revision 1.44  2003/09/30 16:22:05  vasilche
* Updated internal object manager classes to be able to load ID2 data.
* SNP blobs are loaded as ID2 split blobs - readers convert them automatically.
* Scope caches results of requests for data to data loaders.
* Optimized CSeq_id_Handle for gis.
* Optimized bioseq lookup in scope.
* Reduced object allocations in annotation iterators.
* CScope is allowed to be destroyed before other objects using this scope are
* deleted (feature iterators, bioseq handles etc).
* Optimized lookup for matching Seq-ids in CSeq_id_Mapper.
* Added 'adaptive' option to objmgr_demo application.
*
* Revision 1.43  2003/09/05 18:45:10  grichenk
* Fixed exceptions
*
* Revision 1.42  2003/07/14 21:13:27  grichenk
* Added possibility to resolve seq-map iterator withing a single TSE
* and to skip intermediate references during this resolving.
*
* Revision 1.41  2003/06/12 18:39:46  vasilche
* Chech CSeqVector assignment.
*
* Revision 1.40  2003/06/02 21:04:25  vasilche
* Fixed CSeqVector_CI test to not to go beyond begin().
*
* Revision 1.39  2003/06/02 16:06:39  dicuccio
* Rearranged src/objects/ subtree.  This includes the following shifts:
*     - src/objects/asn2asn --> arc/app/asn2asn
*     - src/objects/testmedline --> src/objects/ncbimime/test
*     - src/objects/objmgr --> src/objmgr
*     - src/objects/util --> src/objmgr/util
*     - src/objects/alnmgr --> src/objtools/alnmgr
*     - src/objects/flat --> src/objtools/flat
*     - src/objects/validator --> src/objtools/validator
*     - src/objects/cddalignview --> src/objtools/cddalignview
* In addition, libseq now includes six of the objects/seq... libs, and libmmdb
* replaces the three libmmdb? libs.
*
* Revision 1.37  2003/05/28 16:20:16  vasilche
* Added check for REF segments.
*
* Revision 1.36  2003/05/27 19:44:07  grichenk
* Added CSeqVector_CI class
*
* Revision 1.35  2003/05/23 16:32:54  vasilche
* Added tests for backward traversal of CSeqMap_CI.
*
* Revision 1.34  2003/05/12 19:17:42  vasilche
* Added initialization of mandatory field.
*
* Revision 1.33  2003/05/09 20:34:23  grichenk
* Reverted to 1.31
*
* Revision 1.32  2003/05/09 20:28:03  grichenk
* Changed warnings to info
*
* Revision 1.31  2003/04/24 16:12:39  vasilche
* Object manager internal structures are splitted more straightforward.
* Removed excessive header dependencies.
*
* Revision 1.30  2003/03/26 14:30:23  lavr
* Conform to modified representation of NUL char in NStr::PrintableString()
*
* Revision 1.29  2003/03/21 14:52:28  vasilche
* Modified testobjmgr1 to reflect changes in CFeat_CI and CAlign_CI
* constructors' behaviour.
*
* Revision 1.28  2003/03/05 20:56:44  vasilche
* SAnnotSelector now holds all parameters of annotation iterators.
*
* Revision 1.27  2003/03/04 16:43:53  grichenk
* +Test CFeat_CI with eResolve_All flag
*
* Revision 1.26  2003/02/28 16:37:47  vasilche
* Fixed expected feature count.
* Added optional flags to testobjmgr to dump generated data and found features.
*
* Revision 1.25  2003/01/24 20:13:38  vasilche
* Added check for empty CSeqVector from CBioseq_Handle::GetSequenceView().
*
* Revision 1.24  2003/01/22 20:11:55  vasilche
* Merged functionality of CSeqMapResolved_CI to CSeqMap_CI.
* CSeqMap_CI now supports resolution and iteration over sequence range.
* Added several caches to CScope.
* Optimized CSeqVector().
* Added serveral variants of CBioseqHandle::GetSeqVector().
* Tried to optimize annotations iterator (not much success).
* Rewritten CHandleRange and CHandleRangeMap classes to avoid sorting of list.
*
* Revision 1.23  2003/01/22 19:25:11  ucko
* Avoid use of xobjutil.
*
* Revision 1.22  2002/12/26 20:34:53  ucko
* Drop unused header <sstream>, which older compilers (such as GCC 2.9x) lack;
* move CVS log to end.
*
* Revision 1.21  2002/12/26 16:39:24  vasilche
* Object manager class CSeqMap rewritten.
*
* Revision 1.20  2002/12/20 20:54:25  grichenk
* Added optional location/product switch to CFeat_CI
*
* Revision 1.19  2002/12/19 20:18:57  grichenk
* Fixed test case for minus strand location
*
* Revision 1.18  2002/11/08 19:43:37  grichenk
* CConstRef<> constructor made explicit
*
* Revision 1.17  2002/09/10 19:55:54  grichenk
* Catch exceptions when resolving seq-maps; new arguments for GetSeqVector()
*
* Revision 1.16  2002/07/25 15:01:53  grichenk
* Replaced non-const GetXXX() with SetXXX()
*
* Revision 1.15  2002/07/03 14:40:46  ucko
* Use typedef rather than hard-coded type for Dense_diag.ids.
*
* Revision 1.14  2002/06/07 16:13:24  ucko
* GetTitle() is now in sequence::.
*
* Revision 1.13  2002/06/06 19:49:54  clausen
* Changed CBioseq_Handle::GetTitle() call to GetTitle()
*
* Revision 1.12  2002/05/24 14:57:14  grichenk
* SerialAssign<>() -> CSerialObject::Assign()
*
* Revision 1.11  2002/05/21 18:39:31  grichenk
* CBioseq_Handle::GetResolvedSeqMap() -> CreateResolvedSeqMap()
*
* Revision 1.10  2002/05/09 14:21:50  grichenk
* Turned GetTitle() test on, removed unresolved seq-map test
*
* Revision 1.9  2002/05/06 03:28:53  vakatov
* OM/OM1 renaming
*
* Revision 1.8  2002/05/03 21:28:12  ucko
* Introduce T(Signed)SeqPos.
*
* Revision 1.7  2002/04/25 18:15:25  grichenk
* Adjusted tests to work with the updated CSeqVector
*
* Revision 1.6  2002/04/23 15:26:07  gouriano
* added test_assert.h
*
* Revision 1.5  2002/04/22 20:07:45  grichenk
* Commented calls to CBioseq::ConstructExcludedSequence()
*
* Revision 1.4  2002/04/22 18:33:48  gouriano
* corrected feature counts
*
* Revision 1.3  2002/03/28 21:22:38  grichenk
* More tests for location-exclusive bioseq
*
* Revision 1.2  2002/03/18 21:47:15  grichenk
* Moved most includes to test_helper.cpp
* Added test for CBioseq::ConstructExcludedSequence()
*
* Revision 1.1  2002/03/13 18:06:31  gouriano
* restructured MT test. Put common functions into a separate file
*
* ===========================================================================
*/